EMAIL THIS PAGE TO A FRIEND

GNL3

guanine nucleotide binding protein-like 3 (nucleolar)

92 Gene Product Result for
Synonyms: C77032 E2IG3 NNP47 NS
UniProtKB ID: Q9BVP2, B2RDC1, Q5PU80, Q96SV6, Q96SV7, Q9UJY0
Gene ID:
Human(26354) Summary: The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(30877) guanine nucleotide binding protein-like 3 (nucleolar)
Rat(290556) guanine nucleotide binding protein-like 3 (nucleolar)
sheep(101110004) guanine nucleotide binding protein-like 3 (nucleolar)
Domestic Rabbit(100348740) guanine nucleotide binding protein-like 3 (nucleolar)
domestic guinea pig(100728491) guanine nucleotide binding protein-like 3 (nucleolar)
naked mole-rat(101698337) guanine nucleotide binding protein-like 3 (nucleolar)
Zebrafish(321897) guanine nucleotide binding protein-like 3 (nucleolar)
domestic cat(101092921) guanine nucleotide binding protein-like 3 (nucleolar)
dog(100685258) guanine nucleotide binding protein-like 3 (nucleolar)
cow(506152) guanine nucleotide binding protein-like 3 (nucleolar)
chicken(415897) guanine nucleotide binding protein-like 3 (nucleolar)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105286 Anti-GNL3 (16-30) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1407312 Anti-GNL3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412580 ANTI-GNL3 antibody produced in mouse clone 1G4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412581 ANTI-GNL3 antibody produced in mouse clone 4B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412582 ANTI-GNL3 antibody produced in mouse clone 2B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2106203 Anti-GNL3 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2104519 Anti-GNL3, (N-terminal) antibody produced in rabbit affinity isolated antibody bovine, rat, rabbit, canine, human, mouse, guinea pig, horse
western blot pricing
GW22621 Anti-Nucleostemin antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
WH0026354M1 Monoclonal Anti-GNL3 antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405018 Monoclonal Anti-GNL3 antibody produced in mouse clone 3A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014366 Rosetta Predictions human pricing
NM_206825 Rosetta Predictions human pricing
NM_206826 Rosetta Predictions human pricing
NM_175580 Rosetta Predictions rat pricing
NM_153547 Rosetta Predictions mouse pricing
NM_178846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088959 predicted 1143
2 SASI_Hs02_00345516 predicted 1240
3 SASI_Hs01_00088960 predicted 464
4 SASI_Hs01_00088961 predicted 582
5 SASI_Hs01_00088962 predicted 1507
6 SASI_Hs01_00088963 predicted 1421
7 SASI_Hs01_00088964 predicted 1096
8 SASI_Hs02_00345517 predicted 969
9 SASI_Hs01_00088965 predicted 839
10 SASI_Hs01_00088966 predicted 1003
11 SASI_Hs01_00088967 predicted 950
12 SASI_Hs01_00088968 predicted 1578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049195 predicted 1246
2 SASI_Hs02_00373547 predicted 1337
3 SASI_Hs01_00049196 predicted 560
4 SASI_Hs01_00049197 predicted 676
5 SASI_Hs01_00049198 predicted 1598
6 SASI_Hs01_00049199 predicted 1517
7 SASI_Hs01_00049200 predicted 1189
8 SASI_Hs02_00373548 predicted 1072
9 SASI_Hs01_00049201 predicted 935
10 SASI_Hs01_00049202 predicted 1099
11 SASI_Hs01_00049203 predicted 1040
12 SASI_Hs01_00049204 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095964 predicted 1099
2 SASI_Hs02_00373549 predicted 1191
3 SASI_Hs01_00095965 predicted 417
4 SASI_Hs01_00095966 predicted 527
5 SASI_Hs01_00095967 predicted 1458
6 SASI_Hs01_00095968 predicted 1371
7 SASI_Hs01_00095969 predicted 1045
8 SASI_Hs02_00373550 predicted 926
9 SASI_Hs01_00095970 predicted 794
10 SASI_Hs01_00095971 predicted 948
11 SASI_Hs01_00095972 predicted 890
12 SASI_Hs01_00095973 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044782 predicted 273
2 SASI_Rn01_00044783 predicted 940
3 SASI_Rn02_00269480 predicted 453
4 SASI_Rn01_00044778 predicted 863
5 SASI_Rn01_00044784 predicted 900
6 SASI_Rn01_00044779 predicted 920
7 SASI_Rn01_00044786 predicted 1200
8 SASI_Rn01_00044787 predicted 1006
9 SASI_Rn02_00269481 predicted 893
10 SASI_Rn02_00269482 predicted 675
11 SASI_Rn01_00044780 predicted 1287
12 SASI_Rn01_00044781 predicted 407
13 SASI_Rn01_00044785 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343314 predicted 299
2 SASI_Mm01_00143754 predicted 976
3 SASI_Mm01_00143755 predicted 704
4 SASI_Mm01_00143756 predicted 1029
5 SASI_Mm01_00143757 predicted 937
6 SASI_Mm01_00143758 predicted 1292
7 SASI_Mm02_00343315 predicted 705
8 SASI_Mm01_00143759 predicted 519
9 SASI_Mm01_00143760 predicted 956
10 SASI_Mm01_00143761 predicted 442
11 SASI_Mm01_00143762 predicted 965
12 SASI_Mm01_00143763 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095980 predicted 879
2 SASI_Mm01_00095981 predicted 618
3 SASI_Mm01_00095982 predicted 929
4 SASI_Mm01_00095983 predicted 842
5 SASI_Mm01_00095984 predicted 1189
6 SASI_Mm01_00095985 predicted 428
7 SASI_Mm01_00095986 predicted 870
8 SASI_Mm01_00095987 predicted 349
9 SASI_Mm01_00095988 predicted 896
10 SASI_Mm01_00095989 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206826
VALIDATED
GNL3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 3 (nucleolar)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1048s21c1
Sequence:CCGGTTCATCGTATCTCCACTTAATCTCGAGATTAAGTGGAGATACGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-884s21c1
Sequence:CCGGCCATTCGGGTTGGAGTAATTGCTCGAGCAATTACTCCAACCCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1822s21c1
Sequence:CCGGGCTAAACTGTTCTCTGTATAACTCGAGTTATACAGAGAACAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1310s21c1
Sequence:CCGGGTGCCTCATTAGCTTACTATTCTCGAGAATAGTAAGCTAATGAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-683s21c1
Sequence:CCGGATTTGGAGAGCTGGCTAAATTCTCGAGAATTTAGCCAGCTCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_206826.1-1822s1c1
Sequence:CCGGGCTAAACTGTTCTCTGTATAACTCGAGTTATACAGAGAACAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-409s1c1
Sequence:CCGGCCTGATATTAAGCCATCAAATCTCGAGATTTGATGGCTTAATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1097s1c1
Sequence:CCGGCAGCAAGTATTGAAGTAGTAACTCGAGTTACTACTTCAATACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1010s1c1
Sequence:CCGGCCTTGGACAAACAGATCACAACTCGAGTTGTGATCTGTTTGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1493s1c1
Sequence:CCGGCCGGTCTGACAAATGGAATAACTCGAGTTATTCCATTTGTCAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206826
VALIDATED
GNL3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 3 (nucleolar)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1048s21c1
Sequence:CCGGTTCATCGTATCTCCACTTAATCTCGAGATTAAGTGGAGATACGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-884s21c1
Sequence:CCGGCCATTCGGGTTGGAGTAATTGCTCGAGCAATTACTCCAACCCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1822s21c1
Sequence:CCGGGCTAAACTGTTCTCTGTATAACTCGAGTTATACAGAGAACAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1310s21c1
Sequence:CCGGGTGCCTCATTAGCTTACTATTCTCGAGAATAGTAAGCTAATGAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-683s21c1
Sequence:CCGGATTTGGAGAGCTGGCTAAATTCTCGAGAATTTAGCCAGCTCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_206826.1-1822s1c1
Sequence:CCGGGCTAAACTGTTCTCTGTATAACTCGAGTTATACAGAGAACAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-409s1c1
Sequence:CCGGCCTGATATTAAGCCATCAAATCTCGAGATTTGATGGCTTAATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1097s1c1
Sequence:CCGGCAGCAAGTATTGAAGTAGTAACTCGAGTTACTACTTCAATACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1010s1c1
Sequence:CCGGCCTTGGACAAACAGATCACAACTCGAGTTGTGATCTGTTTGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1493s1c1
Sequence:CCGGCCGGTCTGACAAATGGAATAACTCGAGTTATTCCATTTGTCAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206826
VALIDATED
GNL3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 3 (nucleolar)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1048s21c1
Sequence:CCGGTTCATCGTATCTCCACTTAATCTCGAGATTAAGTGGAGATACGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-884s21c1
Sequence:CCGGCCATTCGGGTTGGAGTAATTGCTCGAGCAATTACTCCAACCCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1822s21c1
Sequence:CCGGGCTAAACTGTTCTCTGTATAACTCGAGTTATACAGAGAACAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-1310s21c1
Sequence:CCGGGTGCCTCATTAGCTTACTATTCTCGAGAATAGTAAGCTAATGAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_206826.1-683s21c1
Sequence:CCGGATTTGGAGAGCTGGCTAAATTCTCGAGAATTTAGCCAGCTCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_206826.1-1822s1c1
Sequence:CCGGGCTAAACTGTTCTCTGTATAACTCGAGTTATACAGAGAACAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-409s1c1
Sequence:CCGGCCTGATATTAAGCCATCAAATCTCGAGATTTGATGGCTTAATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1097s1c1
Sequence:CCGGCAGCAAGTATTGAAGTAGTAACTCGAGTTACTACTTCAATACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1010s1c1
Sequence:CCGGCCTTGGACAAACAGATCACAACTCGAGTTGTGATCTGTTTGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206826.1-1493s1c1
Sequence:CCGGCCGGTCTGACAAATGGAATAACTCGAGTTATTCCATTTGTCAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153547
VALIDATED
GNL3 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 3 (nucleolar)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-1440s1c1
Sequence:CCGGGCCCTCATTTAACTAATAGAACTCGAGTTCTATTAGTTAAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-1029s1c1
Sequence:CCGGGCCTAATTATCTCACCTTGTACTCGAGTACAAGGTGAGATAATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-281s1c1
Sequence:CCGGGCTCCCTTTAAAGAGGCTCTTCTCGAGAAGAGCCTCTTTAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-533s1c1
Sequence:CCGGGCCTCAGACATTGTGTTAGAACTCGAGTTCTAACACAATGTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153547.2-909s1c1
Sequence:CCGGGCAGTGTCATTAATAGCTTAACTCGAGTTAAGCTATTAATGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153547
VALIDATED
GNL3 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 3 (nucleolar)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-1440s1c1
Sequence:CCGGGCCCTCATTTAACTAATAGAACTCGAGTTCTATTAGTTAAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-1029s1c1
Sequence:CCGGGCCTAATTATCTCACCTTGTACTCGAGTACAAGGTGAGATAATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-281s1c1
Sequence:CCGGGCTCCCTTTAAAGAGGCTCTTCTCGAGAAGAGCCTCTTTAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-533s1c1
Sequence:CCGGGCCTCAGACATTGTGTTAGAACTCGAGTTCTAACACAATGTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153547.2-909s1c1
Sequence:CCGGGCAGTGTCATTAATAGCTTAACTCGAGTTAAGCTATTAATGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153547
VALIDATED
GNL3 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 3 (nucleolar)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-1440s1c1
Sequence:CCGGGCCCTCATTTAACTAATAGAACTCGAGTTCTATTAGTTAAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-1029s1c1
Sequence:CCGGGCCTAATTATCTCACCTTGTACTCGAGTACAAGGTGAGATAATTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-281s1c1
Sequence:CCGGGCTCCCTTTAAAGAGGCTCTTCTCGAGAAGAGCCTCTTTAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153547.2-533s1c1
Sequence:CCGGGCCTCAGACATTGTGTTAGAACTCGAGTTCTAACACAATGTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153547.2-909s1c1
Sequence:CCGGGCAGTGTCATTAATAGCTTAACTCGAGTTAAGCTATTAATGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks