EMAIL THIS PAGE TO A FRIEND

GNL3L

guanine nucleotide binding protein-like 3 (nucleolar)-like

320 Gene Product Result for
UniProtKB ID: Q9NVN8
Gene ID:
Human(54552) Summary: The protein encoded by this gene appears to be a nucleolar GTPase that is essential for ribosomal pre-rRNA processing and cell proliferation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
Mouse(237107) guanine nucleotide binding protein-like 3 (nucleolar)-like
Rat(100034253) guanine nucleotide binding protein-like 3 (nucleolar)-like
Zebrafish(442932) guanine nucleotide binding protein-like 3 (nucleolar)-like
cow(507679) guanine nucleotide binding protein-like 3 (nucleolar)-like
domestic cat(101093501) guanine nucleotide binding protein-like 3 (nucleolar)-like
dog(480933) guanine nucleotide binding protein-like 3 (nucleolar)-like
domestic guinea pig(100720663) guanine nucleotide binding protein-like 3 (nucleolar)-like
naked mole-rat(101721379) guanine nucleotide binding protein-like 3 (nucleolar)-like
sheep(101108370) guanine nucleotide binding protein-like 3 (nucleolar)-like
Domestic Rabbit(100343424) guanine nucleotide binding protein-like 3 (nucleolar)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019067 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU050401 MISSION® esiRNA esiRNA targeting mouse Gnl3l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019067 Rosetta Predictions human pricing
NM_001081958 Rosetta Predictions rat pricing
NM_198110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194913 predicted 1035
2 SASI_Hs01_00194914 predicted 1467
3 SASI_Hs01_00194915 predicted 863
4 SASI_Hs01_00194916 predicted 1570
5 SASI_Hs01_00194917 predicted 1435
6 SASI_Hs01_00194918 predicted 1389
7 SASI_Hs01_00194919 predicted 1507
8 SASI_Hs01_00194920 predicted 898
9 SASI_Hs01_00194921 predicted 1319
10 SASI_Hs01_00194922 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208649 predicted 1491
2 SASI_Rn02_00208650 predicted 441
3 SASI_Rn02_00208651 predicted 402
4 SASI_Rn02_00208652 predicted 429
5 SASI_Rn02_00208653 predicted 1091
6 SASI_Rn02_00208654 predicted 604
7 SASI_Rn02_00208655 predicted 1503
8 SASI_Rn02_00208656 predicted 534
9 SASI_Rn02_00208657 predicted 998
10 SASI_Rn02_00208658 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350839 predicted 1894
2 SASI_Mm02_00350840 predicted 1124
3 SASI_Mm02_00350841 predicted 1425
4 SASI_Mm02_00350842 predicted 561
5 SASI_Mm02_00350843 predicted 398
6 SASI_Mm02_00350844 predicted 479
7 SASI_Mm02_00350845 predicted 468
8 SASI_Mm02_00350846 predicted 1132
9 SASI_Mm02_00350847 predicted 1535
10 SASI_Mm02_00350848 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019067
VALIDATED
GNL3L MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 3 (nucleolar)-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-1487s1c1
Sequence:CCGGCGGAGAATCTGATGAGCTGTTCTCGAGAACAGCTCATCAGATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-1595s1c1
Sequence:CCGGCGTGTATAAGATTGGAGATCTCTCGAGAGATCTCCAATCTTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-663s1c1
Sequence:CCGGGTCCTGGTCTTGAACAAGATTCTCGAGAATCTTGTTCAAGACCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-315s1c1
Sequence:CCGGGCCAATCGAGAGGCTGAATTACTCGAGTAATTCAGCCTCTCGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-212s1c1
Sequence:CCGGCAAGAAGATAAGTTGGCCCTACTCGAGTAGGGCCAACTTATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-2323s1c1
Sequence:CCGGGAGACCCATTACCACCGTTAACTCGAGTTAACGGTGGTAATGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-1171s21c1
Sequence:CCGGGGAGGAGATTTCCAACTATTACTCGAGTAATAGTTGGAAATCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-1257s21c1
Sequence:CCGGAGAAGAAGGGAGGCTTATATACTCGAGTATATAAGCCTCCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019067.4-5278s21c1
Sequence:CCGGCCACTACCACAATCGAAATATCTCGAGATATTTCGATTGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-298s21c1
Sequence:GTACCGGCAATCGAGAGGCTGAATTAAACTCGAGTTTAATTCAGCCTCTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-494s21c1
Sequence:CCGGGCCACGAGGAAGGCTTATTACCTCGAGGTAATAAGCCTTCCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019067
VALIDATED
GNL3L MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 3 (nucleolar)-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-1487s1c1
Sequence:CCGGCGGAGAATCTGATGAGCTGTTCTCGAGAACAGCTCATCAGATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-1595s1c1
Sequence:CCGGCGTGTATAAGATTGGAGATCTCTCGAGAGATCTCCAATCTTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-663s1c1
Sequence:CCGGGTCCTGGTCTTGAACAAGATTCTCGAGAATCTTGTTCAAGACCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-315s1c1
Sequence:CCGGGCCAATCGAGAGGCTGAATTACTCGAGTAATTCAGCCTCTCGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-212s1c1
Sequence:CCGGCAAGAAGATAAGTTGGCCCTACTCGAGTAGGGCCAACTTATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-2323s1c1
Sequence:CCGGGAGACCCATTACCACCGTTAACTCGAGTTAACGGTGGTAATGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-1171s21c1
Sequence:CCGGGGAGGAGATTTCCAACTATTACTCGAGTAATAGTTGGAAATCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-1257s21c1
Sequence:CCGGAGAAGAAGGGAGGCTTATATACTCGAGTATATAAGCCTCCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019067.4-5278s21c1
Sequence:CCGGCCACTACCACAATCGAAATATCTCGAGATATTTCGATTGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-298s21c1
Sequence:GTACCGGCAATCGAGAGGCTGAATTAAACTCGAGTTTAATTCAGCCTCTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-494s21c1
Sequence:CCGGGCCACGAGGAAGGCTTATTACCTCGAGGTAATAAGCCTTCCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019067
VALIDATED
GNL3L MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 3 (nucleolar)-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-1487s1c1
Sequence:CCGGCGGAGAATCTGATGAGCTGTTCTCGAGAACAGCTCATCAGATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-1595s1c1
Sequence:CCGGCGTGTATAAGATTGGAGATCTCTCGAGAGATCTCCAATCTTATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-663s1c1
Sequence:CCGGGTCCTGGTCTTGAACAAGATTCTCGAGAATCTTGTTCAAGACCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-315s1c1
Sequence:CCGGGCCAATCGAGAGGCTGAATTACTCGAGTAATTCAGCCTCTCGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019067.3-212s1c1
Sequence:CCGGCAAGAAGATAAGTTGGCCCTACTCGAGTAGGGCCAACTTATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019067.3-2323s1c1
Sequence:CCGGGAGACCCATTACCACCGTTAACTCGAGTTAACGGTGGTAATGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-1171s21c1
Sequence:CCGGGGAGGAGATTTCCAACTATTACTCGAGTAATAGTTGGAAATCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-1257s21c1
Sequence:CCGGAGAAGAAGGGAGGCTTATATACTCGAGTATATAAGCCTCCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019067.4-5278s21c1
Sequence:CCGGCCACTACCACAATCGAAATATCTCGAGATATTTCGATTGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-298s21c1
Sequence:GTACCGGCAATCGAGAGGCTGAATTAAACTCGAGTTTAATTCAGCCTCTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019067.4-494s21c1
Sequence:CCGGGCCACGAGGAAGGCTTATTACCTCGAGGTAATAAGCCTTCCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198110
VALIDATED
GNL3L MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein-like 3 (nucleolar)-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198110.1-242s1c1
Sequence:CCGGCGAGGCCGAATTAAAGAAGAACTCGAGTTCTTCTTTAATTCGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1514s1c1
Sequence:CCGGCACCGTGTATAAGATTGGAAACTCGAGTTTCCAATCTTATACACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198110.1-4176s1c1
Sequence:CCGGCCCGGTTATTTAGACACCTTTCTCGAGAAAGGTGTCTAAATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1513s1c1
Sequence:CCGGGCACCGTGTATAAGATTGGAACTCGAGTTCCAATCTTATACACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1126s1c1
Sequence:CCGGGCTACTATGGTGTATCTGGATCTCGAGATCCAGATACACCATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198110
VALIDATED
GNL3L MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein-like 3 (nucleolar)-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198110.1-242s1c1
Sequence:CCGGCGAGGCCGAATTAAAGAAGAACTCGAGTTCTTCTTTAATTCGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1514s1c1
Sequence:CCGGCACCGTGTATAAGATTGGAAACTCGAGTTTCCAATCTTATACACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198110.1-4176s1c1
Sequence:CCGGCCCGGTTATTTAGACACCTTTCTCGAGAAAGGTGTCTAAATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1513s1c1
Sequence:CCGGGCACCGTGTATAAGATTGGAACTCGAGTTCCAATCTTATACACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1126s1c1
Sequence:CCGGGCTACTATGGTGTATCTGGATCTCGAGATCCAGATACACCATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198110
VALIDATED
GNL3L MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein-like 3 (nucleolar)-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198110.1-242s1c1
Sequence:CCGGCGAGGCCGAATTAAAGAAGAACTCGAGTTCTTCTTTAATTCGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1514s1c1
Sequence:CCGGCACCGTGTATAAGATTGGAAACTCGAGTTTCCAATCTTATACACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198110.1-4176s1c1
Sequence:CCGGCCCGGTTATTTAGACACCTTTCTCGAGAAAGGTGTCTAAATAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1513s1c1
Sequence:CCGGGCACCGTGTATAAGATTGGAACTCGAGTTCCAATCTTATACACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198110.1-1126s1c1
Sequence:CCGGGCTACTATGGTGTATCTGGATCTCGAGATCCAGATACACCATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks