EMAIL THIS PAGE TO A FRIEND

GNLY

granulysin

62 Gene Product Result for
Synonyms: 519 D2S69E LAG-2 LAG2 NKG5 TLA519
UniProtKB ID: P22749, P09325, Q6GU08
Gene ID:
Human(10578) Summary: The product of this gene is a member of the saposin-like protein (SAPLIP) family and is located in the cytotoxic granules of T cells, which are released upon antigen stimulation. This protein is present in cytotoxic granules of cytotoxic T lymphocytes and natural killer cells, and it has antimicrobial activity against M. tuberculosis and other organisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
cow(404173) granulysin
sheep(100125622) granulysin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006433 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006433 Rosetta Predictions human pricing
NM_012483 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030020 predicted 438
2 SASI_Hs01_00030021 predicted 485
3 SASI_Hs02_00341558 predicted 430
4 SASI_Hs02_00341559 predicted 501
5 SASI_Hs01_00030027 predicted 442
6 SASI_Hs02_00341560 predicted 485
7 SASI_Hs02_00341561 predicted 430
8 SASI_Hs02_00341562 predicted 497
9 SASI_Hs02_00341563 predicted 433
10 SASI_Hs02_00341564 predicted 418
11 SASI_Hs01_00030019 predicted 300
12 SASI_Hs01_00030022 predicted 458
13 SASI_Hs01_00030023 predicted 321
14 SASI_Hs01_00030024 predicted 332
15 SASI_Hs01_00030025 predicted 329
16 SASI_Hs01_00030026 predicted 466
17 SASI_Hs01_00030028 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344397 predicted 621
2 SASI_Hs02_00344398 predicted 681
3 SASI_Hs02_00344399 predicted 726
4 SASI_Hs02_00344400 predicted 678
5 SASI_Hs02_00344401 predicted 751
6 SASI_Hs01_00102881 predicted 683
7 SASI_Hs02_00344402 predicted 723
8 SASI_Hs02_00344403 predicted 673
9 SASI_Hs01_00102884 predicted 739
10 SASI_Hs02_00344404 predicted 674
11 SASI_Hs01_00102877 predicted 413
12 SASI_Hs01_00102878 predicted 634
13 SASI_Hs01_00102879 predicted 573
14 SASI_Hs01_00102880 predicted 570
15 SASI_Hs01_00102882 predicted 295
16 SASI_Hs01_00102883 predicted 563
17 SASI_Hs01_00102885 predicted 419
18 SASI_Hs01_00102886 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006433
GNLY MISSION shRNA Bacterial Glycerol Stock
granulysin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-378s21c1
Sequence:CCGGACCCAGAGAAGTGTTTCCAATCTCGAGATTGGAAACACTTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-438s21c1
Sequence:CCGGCGCGACGTCTGCAGAAATTTCCTCGAGGAAATTTCTGCAGACGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-194s21c1
Sequence:CCGGTCGTCTGAGCCCTGAGTACTACTCGAGTAGTACTCAGGGCTCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006433.2-569s1c1
Sequence:CCGGCCTCTCACCTTGTCCTGTGGACTCGAGTCCACAGGACAAGGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-353s1c1
Sequence:CCGGACTGAAGAAGATGGTGGATAACTCGAGTTATCCACCATCTTCTTCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-462s1c1
Sequence:CCGGAGGAGGTATCAGTCTAGAGTTCTCGAGAACTCTAGACTGATACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-331s1c1
Sequence:CCGGCCTGTCTGACGATAGTCCAAACTCGAGTTTGGACTATCGTCAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-525s1c1
Sequence:CCGGGAGGACCTCAGGTTGTGTATACTCGAGTATACACAACCTGAGGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006433
GNLY MISSION shRNA shRNA Plasmid DNA
granulysin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-378s21c1
Sequence:CCGGACCCAGAGAAGTGTTTCCAATCTCGAGATTGGAAACACTTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-438s21c1
Sequence:CCGGCGCGACGTCTGCAGAAATTTCCTCGAGGAAATTTCTGCAGACGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-194s21c1
Sequence:CCGGTCGTCTGAGCCCTGAGTACTACTCGAGTAGTACTCAGGGCTCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006433.2-569s1c1
Sequence:CCGGCCTCTCACCTTGTCCTGTGGACTCGAGTCCACAGGACAAGGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-353s1c1
Sequence:CCGGACTGAAGAAGATGGTGGATAACTCGAGTTATCCACCATCTTCTTCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-462s1c1
Sequence:CCGGAGGAGGTATCAGTCTAGAGTTCTCGAGAACTCTAGACTGATACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-331s1c1
Sequence:CCGGCCTGTCTGACGATAGTCCAAACTCGAGTTTGGACTATCGTCAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-525s1c1
Sequence:CCGGGAGGACCTCAGGTTGTGTATACTCGAGTATACACAACCTGAGGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006433
GNLY MISSION shRNA Lentiviral Transduction Particles
granulysin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-378s21c1
Sequence:CCGGACCCAGAGAAGTGTTTCCAATCTCGAGATTGGAAACACTTCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-438s21c1
Sequence:CCGGCGCGACGTCTGCAGAAATTTCCTCGAGGAAATTTCTGCAGACGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006433.3-194s21c1
Sequence:CCGGTCGTCTGAGCCCTGAGTACTACTCGAGTAGTACTCAGGGCTCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006433.2-569s1c1
Sequence:CCGGCCTCTCACCTTGTCCTGTGGACTCGAGTCCACAGGACAAGGTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-353s1c1
Sequence:CCGGACTGAAGAAGATGGTGGATAACTCGAGTTATCCACCATCTTCTTCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-462s1c1
Sequence:CCGGAGGAGGTATCAGTCTAGAGTTCTCGAGAACTCTAGACTGATACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-331s1c1
Sequence:CCGGCCTGTCTGACGATAGTCCAAACTCGAGTTTGGACTATCGTCAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006433.2-525s1c1
Sequence:CCGGGAGGACCTCAGGTTGTGTATACTCGAGTATACACAACCTGAGGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks