EMAIL THIS PAGE TO A FRIEND

GNMT

glycine N-methyltransferase

UniProtKB ID: Q14749, Q5T8W2, Q9NNZ1, Q9NS24
Gene ID:
Human(27232) Summary: The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. The encoded protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). [provided by RefSeq, Oct 2008]
Mouse(14711) glycine N-methyltransferase
Rat(25134) glycine N-methyltransferase
sheep(101111134) glycine N-methyltransferase
Domestic Rabbit(100009512) glycine N-methyltransferase
domestic guinea pig(100717389) glycine N-methyltransferase
naked mole-rat(101697457) glycine N-methyltransferase
Zebrafish(403338) glycine N-methyltransferase
chicken(769542) glycine N-methyltransferase
domestic cat(101083006) glycine N-methyltransferase
cow(538212) glycine N-methyltransferase
dog(474905) glycine N-methyltransferase
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1489 Human GNMT ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018960 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018960 Rosetta Predictions human pricing
NM_017084 Rosetta Predictions rat pricing
NM_010321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060850 predicted 715
2 SASI_Hs01_00060851 predicted 424
3 SASI_Hs01_00060852 predicted 272
4 SASI_Hs01_00060853 predicted 347
5 SASI_Hs01_00060854 predicted 597
6 SASI_Hs02_00352435 predicted 424
7 SASI_Hs01_00060855 predicted 545
8 SASI_Hs01_00060856 predicted 825
9 SASI_Hs01_00060857 predicted 619
10 SASI_Hs01_00060858 predicted 655
11 SASI_Hs01_00060849 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017084 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105603 predicted 198
2 SASI_Rn01_00105604 predicted 395
3 SASI_Rn01_00105606 predicted 330
4 SASI_Rn01_00105607 predicted 347
5 SASI_Rn01_00105608 predicted 594
6 SASI_Rn01_00105609 predicted 644
7 SASI_Rn01_00105610 predicted 718
8 SASI_Rn01_00105612 predicted 454
9 SASI_Rn02_00261297 predicted 470
10 SASI_Rn02_00261298 predicted 592
11 SASI_Rn01_00105605 predicted 625
12 SASI_Rn01_00105611 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122300 predicted 247
2 SASI_Mm01_00122301 predicted 745
3 SASI_Mm01_00122302 predicted 618
4 SASI_Mm01_00122303 predicted 381
5 SASI_Mm01_00122304 predicted 596
6 SASI_Mm01_00122305 predicted 275
7 SASI_Mm01_00122307 predicted 351
8 SASI_Mm01_00122308 predicted 408
9 SASI_Mm01_00122309 predicted 311
10 SASI_Mm02_00318322 predicted 602
11 SASI_Mm01_00122306 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018960
GNMT MISSION shRNA Bacterial Glycerol Stock
glycine N-methyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-852s1c1
Sequence:CCGGCCTACATTCCCTGCTACTTCACTCGAGTGAAGTAGCAGGGAATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-856s1c1
Sequence:CCGGCATTCCCTGCTACTTCATCCACTCGAGTGGATGAAGTAGCAGGGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-640s1c1
Sequence:CCGGGATAGTGAACAACAAGGCCCACTCGAGTGGGCCTTGTTGTTCACTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018960.x-1031s1c1
Sequence:CCGGCAGACGGAAGGGTAAACAATACTCGAGTATTGTTTACCCTTCCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-847s1c1
Sequence:CCGGCCAAACCTACATTCCCTGCTACTCGAGTAGCAGGGAATGTAGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-269s21c1
Sequence:CCGGGTGACAAGATGCTGAAGTATGCTCGAGCATACTTCAGCATCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-518s21c1
Sequence:CCGGGCCTACTGGTCATTGATCATCCTCGAGGATGATCAATGACCAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-331s21c1
Sequence:CCGGGACAAGTGGGTCATCGAAGAACTCGAGTTCTTCGATGACCCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-605s21c1
Sequence:CCGGACTTGACCAAGGACGTCACAACTCGAGTTGTGACGTCCTTGGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018960
GNMT MISSION shRNA shRNA Plasmid DNA
glycine N-methyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-852s1c1
Sequence:CCGGCCTACATTCCCTGCTACTTCACTCGAGTGAAGTAGCAGGGAATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-856s1c1
Sequence:CCGGCATTCCCTGCTACTTCATCCACTCGAGTGGATGAAGTAGCAGGGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-640s1c1
Sequence:CCGGGATAGTGAACAACAAGGCCCACTCGAGTGGGCCTTGTTGTTCACTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018960.x-1031s1c1
Sequence:CCGGCAGACGGAAGGGTAAACAATACTCGAGTATTGTTTACCCTTCCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-847s1c1
Sequence:CCGGCCAAACCTACATTCCCTGCTACTCGAGTAGCAGGGAATGTAGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-269s21c1
Sequence:CCGGGTGACAAGATGCTGAAGTATGCTCGAGCATACTTCAGCATCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-518s21c1
Sequence:CCGGGCCTACTGGTCATTGATCATCCTCGAGGATGATCAATGACCAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-331s21c1
Sequence:CCGGGACAAGTGGGTCATCGAAGAACTCGAGTTCTTCGATGACCCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-605s21c1
Sequence:CCGGACTTGACCAAGGACGTCACAACTCGAGTTGTGACGTCCTTGGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018960
GNMT MISSION shRNA Lentiviral Transduction Particles
glycine N-methyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-852s1c1
Sequence:CCGGCCTACATTCCCTGCTACTTCACTCGAGTGAAGTAGCAGGGAATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-856s1c1
Sequence:CCGGCATTCCCTGCTACTTCATCCACTCGAGTGGATGAAGTAGCAGGGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-640s1c1
Sequence:CCGGGATAGTGAACAACAAGGCCCACTCGAGTGGGCCTTGTTGTTCACTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018960.x-1031s1c1
Sequence:CCGGCAGACGGAAGGGTAAACAATACTCGAGTATTGTTTACCCTTCCGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018960.x-847s1c1
Sequence:CCGGCCAAACCTACATTCCCTGCTACTCGAGTAGCAGGGAATGTAGGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-269s21c1
Sequence:CCGGGTGACAAGATGCTGAAGTATGCTCGAGCATACTTCAGCATCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-518s21c1
Sequence:CCGGGCCTACTGGTCATTGATCATCCTCGAGGATGATCAATGACCAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-331s21c1
Sequence:CCGGGACAAGTGGGTCATCGAAGAACTCGAGTTCTTCGATGACCCACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018960.4-605s21c1
Sequence:CCGGACTTGACCAAGGACGTCACAACTCGAGTTGTGACGTCCTTGGTCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010321
GNMT MISSION shRNA Bacterial Glycerol Stock
glycine N-methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-536s1c1
Sequence:CCGGCCACCGCAACTACGACTATATCTCGAGATATAGTCGTAGTTGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-373s1c1
Sequence:CCGGCGCTGGACAAAGATGTGCTTTCTCGAGAAAGCACATCTTTGTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-815s1c1
Sequence:CCGGCCTGGGTGACTTCAAGCCCTACTCGAGTAGGGCTTGAAGTCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-283s1c1
Sequence:CCGGAGATGCTGAAATATGCGCTTACTCGAGTAAGCGCATATTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-272s1c1
Sequence:CCGGCGCCAGCGACAAGATGCTGAACTCGAGTTCAGCATCTTGTCGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010321
GNMT MISSION shRNA shRNA Plasmid DNA
glycine N-methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-536s1c1
Sequence:CCGGCCACCGCAACTACGACTATATCTCGAGATATAGTCGTAGTTGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-373s1c1
Sequence:CCGGCGCTGGACAAAGATGTGCTTTCTCGAGAAAGCACATCTTTGTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-815s1c1
Sequence:CCGGCCTGGGTGACTTCAAGCCCTACTCGAGTAGGGCTTGAAGTCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-283s1c1
Sequence:CCGGAGATGCTGAAATATGCGCTTACTCGAGTAAGCGCATATTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-272s1c1
Sequence:CCGGCGCCAGCGACAAGATGCTGAACTCGAGTTCAGCATCTTGTCGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010321
GNMT MISSION shRNA Lentiviral Transduction Particles
glycine N-methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-536s1c1
Sequence:CCGGCCACCGCAACTACGACTATATCTCGAGATATAGTCGTAGTTGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-373s1c1
Sequence:CCGGCGCTGGACAAAGATGTGCTTTCTCGAGAAAGCACATCTTTGTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-815s1c1
Sequence:CCGGCCTGGGTGACTTCAAGCCCTACTCGAGTAGGGCTTGAAGTCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-283s1c1
Sequence:CCGGAGATGCTGAAATATGCGCTTACTCGAGTAAGCGCATATTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010321.1-272s1c1
Sequence:CCGGCGCCAGCGACAAGATGCTGAACTCGAGTTCAGCATCTTGTCGCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks