EMAIL THIS PAGE TO A FRIEND

GNPAT

glyceronephosphate O-acyltransferase

59 Gene Product Result for
Synonyms: DAP-AT DAPAT DHAPAT
UniProtKB ID: O15228, Q5TBH7, Q9BWC2
Gene ID:
Human(8443) Summary: This gene encodes an enzyme located in the peroxisomal membrane which is essential to the synthesis of ether phospholipids. Mutations in this gene are associated with rhizomelic chondrodysplasia punctata. [provided by RefSeq, Jul 2008]
Mouse(14712) glyceronephosphate O-acyltransferase
Rat(84470) glyceronephosphate O-acyltransferase
Zebrafish(572335) glyceronephosphate O-acyltransferase
chicken(421548) glyceronephosphate O-acyltransferase
domestic cat(101090468) glyceronephosphate O-acyltransferase
Horse(100060758) glyceronephosphate O-acyltransferase
dog(479204) glyceronephosphate O-acyltransferase
cow(538800) glyceronephosphate O-acyltransferase
domestic guinea pig(100729104) glyceronephosphate O-acyltransferase
naked mole-rat(101712069) glyceronephosphate O-acyltransferase
sheep(101111422) glyceronephosphate O-acyltransferase
Domestic Rabbit(100353451) glyceronephosphate O-acyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014236 Rosetta Predictions human pricing
NM_053410 Rosetta Predictions rat pricing
NM_010322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345274 predicted 1604
2 SASI_Hs01_00173476 predicted 2038
3 SASI_Hs01_00173477 predicted 1841
4 SASI_Hs01_00173478 predicted 1119
5 SASI_Hs01_00173479 predicted 736
6 SASI_Hs02_00345275 predicted 2293
7 SASI_Hs01_00173481 predicted 363
8 SASI_Hs01_00173482 predicted 1039
9 SASI_Hs01_00173483 predicted 2022
10 SASI_Hs01_00173484 predicted 384
11 SASI_Hs01_00173480 predicted 902
12 SASI_Hs01_00173485 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085252 predicted 670
2 SASI_Rn01_00085253 predicted 902
3 SASI_Rn01_00085254 predicted 1606
4 SASI_Rn01_00085255 predicted 838
5 SASI_Rn01_00085256 predicted 404
6 SASI_Rn01_00085257 predicted 1598
7 SASI_Rn01_00085258 predicted 1684
8 SASI_Rn01_00085259 predicted 225
9 SASI_Rn01_00085260 predicted 885
10 SASI_Rn01_00085261 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159801 predicted 2291
2 SASI_Mm02_00318323 predicted 590
3 SASI_Mm01_00159803 predicted 901
4 SASI_Mm02_00318324 predicted 756
5 SASI_Mm01_00159804 predicted 2034
6 SASI_Mm01_00159805 predicted 1020
7 SASI_Mm01_00159806 predicted 771
8 SASI_Mm01_00159807 predicted 2085
9 SASI_Mm01_00159809 predicted 436
10 SASI_Mm02_00318325 predicted 1713
11 SASI_Mm01_00159802 predicted 997
12 SASI_Mm01_00159808 predicted 2091
13 SASI_Mm01_00159810 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014236
VALIDATED
GNPAT MISSION shRNA Bacterial Glycerol Stock
glyceronephosphate O-acyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014236.3-1144s21c1
Sequence:CCGGCCAGAAAGATTCTCTCTGAAACTCGAGTTTCAGAGAGAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014236.3-1848s21c1
Sequence:CCGGGCCATACAAGTGACTACGAAACTCGAGTTTCGTAGTCACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014236.3-2053s21c1
Sequence:CCGGCCTCTCAATGTTATGATGTATCTCGAGATACATCATAACATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014236.3-954s21c1
Sequence:CCGGGCCAAGACATTGACTCCTAAACTCGAGTTTAGGAGTCAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-1799s1c1
Sequence:CCGGGCCATACAAGTGACTACGAAACTCGAGTTTCGTAGTCACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014236.1-1208s1c1
Sequence:CCGGCCAAGATACATTCCTCAGAAACTCGAGTTTCTGAGGAATGTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-2004s1c1
Sequence:CCGGCCTCTCAATGTTATGATGTATCTCGAGATACATCATAACATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-905s1c1
Sequence:CCGGGCCAAGACATTGACTCCTAAACTCGAGTTTAGGAGTCAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-1095s1c1
Sequence:CCGGCCAGAAAGATTCTCTCTGAAACTCGAGTTTCAGAGAGAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014236
VALIDATED
GNPAT MISSION shRNA shRNA Plasmid DNA
glyceronephosphate O-acyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014236.3-1144s21c1
Sequence:CCGGCCAGAAAGATTCTCTCTGAAACTCGAGTTTCAGAGAGAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014236.3-1848s21c1
Sequence:CCGGGCCATACAAGTGACTACGAAACTCGAGTTTCGTAGTCACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014236.3-2053s21c1
Sequence:CCGGCCTCTCAATGTTATGATGTATCTCGAGATACATCATAACATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014236.3-954s21c1
Sequence:CCGGGCCAAGACATTGACTCCTAAACTCGAGTTTAGGAGTCAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-1799s1c1
Sequence:CCGGGCCATACAAGTGACTACGAAACTCGAGTTTCGTAGTCACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014236.1-1208s1c1
Sequence:CCGGCCAAGATACATTCCTCAGAAACTCGAGTTTCTGAGGAATGTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-2004s1c1
Sequence:CCGGCCTCTCAATGTTATGATGTATCTCGAGATACATCATAACATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-905s1c1
Sequence:CCGGGCCAAGACATTGACTCCTAAACTCGAGTTTAGGAGTCAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-1095s1c1
Sequence:CCGGCCAGAAAGATTCTCTCTGAAACTCGAGTTTCAGAGAGAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014236
VALIDATED
GNPAT MISSION shRNA Lentiviral Transduction Particles
glyceronephosphate O-acyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014236.3-1144s21c1
Sequence:CCGGCCAGAAAGATTCTCTCTGAAACTCGAGTTTCAGAGAGAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014236.3-1848s21c1
Sequence:CCGGGCCATACAAGTGACTACGAAACTCGAGTTTCGTAGTCACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014236.3-2053s21c1
Sequence:CCGGCCTCTCAATGTTATGATGTATCTCGAGATACATCATAACATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014236.3-954s21c1
Sequence:CCGGGCCAAGACATTGACTCCTAAACTCGAGTTTAGGAGTCAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-1799s1c1
Sequence:CCGGGCCATACAAGTGACTACGAAACTCGAGTTTCGTAGTCACTTGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014236.1-1208s1c1
Sequence:CCGGCCAAGATACATTCCTCAGAAACTCGAGTTTCTGAGGAATGTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-2004s1c1
Sequence:CCGGCCTCTCAATGTTATGATGTATCTCGAGATACATCATAACATTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-905s1c1
Sequence:CCGGGCCAAGACATTGACTCCTAAACTCGAGTTTAGGAGTCAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014236.1-1095s1c1
Sequence:CCGGCCAGAAAGATTCTCTCTGAAACTCGAGTTTCAGAGAGAATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010322
VALIDATED
GNPAT MISSION shRNA Bacterial Glycerol Stock
glyceronephosphate O-acyltransferase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1022s21c1
Sequence:CCGGGATACCTACTTTGTCCCAATTCTCGAGAATTGGGACAAAGTAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1226s21c1
Sequence:CCGGCTCAATCGGAACACGTATAACCTCGAGGTTATACGTGTTCCGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.3-2186s1c1
Sequence:CCGGGAAGAAATGCTCGGATGTAAGCTCGAGCTTACATCCGAGCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.3-332s1c1
Sequence:CCGGCACATCAGTGACTTCAAATTTCTCGAGAAATTTGAAGTCACTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010322.3-437s21c1
Sequence:CCGGGAAGAGATCAACTATGTCATTCTCGAGAATGACATAGTTGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1931s21c1
Sequence:CCGGGTGGAATCATATCAGTTACTTCTCGAGAAGTAACTGATATGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-2704s21c1
Sequence:CCGGAGGACGTTCATGTCTAGATTACTCGAGTAATCTAGACATGAACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.2-1681s1c1
Sequence:CCGGGAGGATGTCTTCAGTTGCTTTCTCGAGAAAGCAACTGAAGACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010322.2-1888s1c1
Sequence:CCGGGTGGAATCATATCAGTTACTTCTCGAGAAGTAACTGATATGATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010322.2-394s1c1
Sequence:CCGGGAAGAGATCAACTATGTCATTCTCGAGAATGACATAGTTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010322.2-979s1c1
Sequence:CCGGGATACCTACTTTGTCCCAATTCTCGAGAATTGGGACAAAGTAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010322.2-978s1c1
Sequence:CCGGCGATACCTACTTTGTCCCAATCTCGAGATTGGGACAAAGTAGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010322
VALIDATED
GNPAT MISSION shRNA shRNA Plasmid DNA
glyceronephosphate O-acyltransferase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1022s21c1
Sequence:CCGGGATACCTACTTTGTCCCAATTCTCGAGAATTGGGACAAAGTAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1226s21c1
Sequence:CCGGCTCAATCGGAACACGTATAACCTCGAGGTTATACGTGTTCCGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.3-2186s1c1
Sequence:CCGGGAAGAAATGCTCGGATGTAAGCTCGAGCTTACATCCGAGCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.3-332s1c1
Sequence:CCGGCACATCAGTGACTTCAAATTTCTCGAGAAATTTGAAGTCACTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010322.3-437s21c1
Sequence:CCGGGAAGAGATCAACTATGTCATTCTCGAGAATGACATAGTTGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1931s21c1
Sequence:CCGGGTGGAATCATATCAGTTACTTCTCGAGAAGTAACTGATATGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-2704s21c1
Sequence:CCGGAGGACGTTCATGTCTAGATTACTCGAGTAATCTAGACATGAACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.2-1681s1c1
Sequence:CCGGGAGGATGTCTTCAGTTGCTTTCTCGAGAAAGCAACTGAAGACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010322.2-1888s1c1
Sequence:CCGGGTGGAATCATATCAGTTACTTCTCGAGAAGTAACTGATATGATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010322.2-394s1c1
Sequence:CCGGGAAGAGATCAACTATGTCATTCTCGAGAATGACATAGTTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010322.2-979s1c1
Sequence:CCGGGATACCTACTTTGTCCCAATTCTCGAGAATTGGGACAAAGTAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010322.2-978s1c1
Sequence:CCGGCGATACCTACTTTGTCCCAATCTCGAGATTGGGACAAAGTAGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010322
VALIDATED
GNPAT MISSION shRNA Lentiviral Transduction Particles
glyceronephosphate O-acyltransferase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1022s21c1
Sequence:CCGGGATACCTACTTTGTCCCAATTCTCGAGAATTGGGACAAAGTAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1226s21c1
Sequence:CCGGCTCAATCGGAACACGTATAACCTCGAGGTTATACGTGTTCCGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.3-2186s1c1
Sequence:CCGGGAAGAAATGCTCGGATGTAAGCTCGAGCTTACATCCGAGCATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.3-332s1c1
Sequence:CCGGCACATCAGTGACTTCAAATTTCTCGAGAAATTTGAAGTCACTGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010322.3-437s21c1
Sequence:CCGGGAAGAGATCAACTATGTCATTCTCGAGAATGACATAGTTGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-1931s21c1
Sequence:CCGGGTGGAATCATATCAGTTACTTCTCGAGAAGTAACTGATATGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010322.3-2704s21c1
Sequence:CCGGAGGACGTTCATGTCTAGATTACTCGAGTAATCTAGACATGAACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010322.2-1681s1c1
Sequence:CCGGGAGGATGTCTTCAGTTGCTTTCTCGAGAAAGCAACTGAAGACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010322.2-1888s1c1
Sequence:CCGGGTGGAATCATATCAGTTACTTCTCGAGAAGTAACTGATATGATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010322.2-394s1c1
Sequence:CCGGGAAGAGATCAACTATGTCATTCTCGAGAATGACATAGTTGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010322.2-979s1c1
Sequence:CCGGGATACCTACTTTGTCCCAATTCTCGAGAATTGGGACAAAGTAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010322.2-978s1c1
Sequence:CCGGCGATACCTACTTTGTCCCAATCTCGAGATTGGGACAAAGTAGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks