EMAIL THIS PAGE TO A FRIEND

GNPDA1

glucosamine-6-phosphate deaminase 1

Synonyms: GNP1 GNPDA GNPI GPI HLN
UniProtKB ID: P46926, D3DQE7
Gene ID:
Human(10007) Summary: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) is an allosteric enzyme that catalyzes the reversible conversion of D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium (Arreola et al., 2003 [PubMed 12965206]
Mouse(26384) glucosamine-6-phosphate deaminase 1
Rat(683570) glucosamine-6-phosphate deaminase 1
Zebrafish(550565) glucosamine-6-phosphate deaminase 1
domestic cat(101081521) glucosamine-6-phosphate deaminase 1
cow(522919) glucosamine-6-phosphate deaminase 1
dog(478043) glucosamine-6-phosphate deaminase 1
chicken(416341) glucosamine-6-phosphate deaminase 1
sheep(101108912) glucosamine-6-phosphate deaminase 1
domestic guinea pig(100726426) glucosamine-6-phosphate deaminase 1
naked mole-rat(101714889) glucosamine-6-phosphate deaminase 1
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005471 Rosetta Predictions human pricing
NM_001134995 Rosetta Predictions rat pricing
NM_011937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071893 predicted 1397
2 SASI_Hs02_00339644 predicted 768
3 SASI_Hs02_00339645 predicted 638
4 SASI_Hs01_00071896 predicted 263
5 SASI_Hs02_00339646 predicted 788
6 SASI_Hs02_00339647 predicted 483
7 SASI_Hs01_00071897 predicted 649
8 SASI_Hs01_00071899 predicted 678
9 SASI_Hs01_00071900 predicted 1392
10 SASI_Hs01_00071901 predicted 328
11 SASI_Hs01_00071894 predicted 808
12 SASI_Hs01_00071895 predicted 1396
13 SASI_Hs01_00071898 predicted 797
14 SASI_Hs01_00071902 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259327 predicted 803
2 SASI_Rn02_00259328 predicted 793
3 SASI_Rn02_00259329 predicted 815
4 SASI_Rn02_00259330 predicted 242
5 SASI_Rn02_00259331 predicted 628
6 SASI_Rn02_00259332 predicted 265
7 SASI_Rn02_00259333 predicted 751
8 SASI_Rn02_00259334 predicted 300
9 SASI_Rn02_00259335 predicted 1065
10 SASI_Rn02_00259336 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321782 predicted 265
2 SASI_Mm01_00093354 predicted 291
3 SASI_Mm02_00321783 predicted 1376
4 SASI_Mm01_00093355 predicted 855
5 SASI_Mm02_00321784 predicted 344
6 SASI_Mm01_00093357 predicted 605
7 SASI_Mm01_00093358 predicted 304
8 SASI_Mm02_00321785 predicted 1386
9 SASI_Mm01_00093359 predicted 675
10 SASI_Mm02_00321786 predicted 1373
11 SASI_Mm01_00093353 predicted 913
12 SASI_Mm01_00093356 predicted 753
13 SASI_Mm01_00093360 predicted 320
14 SASI_Mm01_00093361 predicted 792
15 SASI_Mm01_00093362 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005471
VALIDATED
GNPDA1 MISSION shRNA Bacterial Glycerol Stock
glucosamine-6-phosphate deaminase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005471.3-550s1c1
Sequence:CCGGGCTAGGTTCTTCGATGGAGAACTCGAGTTCTCCATCGAAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005471.3-777s1c1
Sequence:CCGGGCTGAAAGTGAAGACTGTCAACTCGAGTTGACAGTCTTCACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005471.3-309s1c1
Sequence:CCGGGAACAACTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005471.3-432s1c1
Sequence:CCGGCGAGCTATTTGTTGGAGGCATCTCGAGATGCCTCCAACAAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005471.4-129s21c1
Sequence:CCGGGGAACCGCATCATCCAGTTTACTCGAGTAAACTGGATGATGCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005471.4-1084s21c1
Sequence:CCGGGGAGCCTAGTCACGGAGTTTACTCGAGTAAACTCCGTGACTAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005471.4-337s21c1
Sequence:CCGGGAACAACTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005471.4-578s21c1
Sequence:CCGGGCTAGGTTCTTCGATGGAGAACTCGAGTTCTCCATCGAAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005471
VALIDATED
GNPDA1 MISSION shRNA shRNA Plasmid DNA
glucosamine-6-phosphate deaminase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005471.3-550s1c1
Sequence:CCGGGCTAGGTTCTTCGATGGAGAACTCGAGTTCTCCATCGAAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005471.3-777s1c1
Sequence:CCGGGCTGAAAGTGAAGACTGTCAACTCGAGTTGACAGTCTTCACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005471.3-309s1c1
Sequence:CCGGGAACAACTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005471.3-432s1c1
Sequence:CCGGCGAGCTATTTGTTGGAGGCATCTCGAGATGCCTCCAACAAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005471.4-129s21c1
Sequence:CCGGGGAACCGCATCATCCAGTTTACTCGAGTAAACTGGATGATGCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005471.4-1084s21c1
Sequence:CCGGGGAGCCTAGTCACGGAGTTTACTCGAGTAAACTCCGTGACTAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005471.4-337s21c1
Sequence:CCGGGAACAACTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005471.4-578s21c1
Sequence:CCGGGCTAGGTTCTTCGATGGAGAACTCGAGTTCTCCATCGAAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005471
VALIDATED
GNPDA1 MISSION shRNA Lentiviral Transduction Particles
glucosamine-6-phosphate deaminase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005471.3-550s1c1
Sequence:CCGGGCTAGGTTCTTCGATGGAGAACTCGAGTTCTCCATCGAAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_005471.3-777s1c1
Sequence:CCGGGCTGAAAGTGAAGACTGTCAACTCGAGTTGACAGTCTTCACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_005471.3-309s1c1
Sequence:CCGGGAACAACTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005471.3-432s1c1
Sequence:CCGGCGAGCTATTTGTTGGAGGCATCTCGAGATGCCTCCAACAAATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005471.4-129s21c1
Sequence:CCGGGGAACCGCATCATCCAGTTTACTCGAGTAAACTGGATGATGCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005471.4-1084s21c1
Sequence:CCGGGGAGCCTAGTCACGGAGTTTACTCGAGTAAACTCCGTGACTAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005471.4-337s21c1
Sequence:CCGGGAACAACTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAAGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005471.4-578s21c1
Sequence:CCGGGCTAGGTTCTTCGATGGAGAACTCGAGTTCTCCATCGAAGAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011937
VALIDATED
GNPDA1 MISSION shRNA Bacterial Glycerol Stock
glucosamine-6-phosphate deaminase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011937.1-1625s1c1
Sequence:CCGGCCTTGTCTTGTTCTCTCTCAACTCGAGTTGAGAGAGAACAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-113s1c1
Sequence:CCGGAGGAACCGTATCATCCAGTTTCTCGAGAAACTGGATGATACGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-307s1c1
Sequence:CCGGCCACTTCTTCATGTGGGATAACTCGAGTTATCCCACATGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-892s1c1
Sequence:CCGGCCAATCTGCTAAGAAGCCATACTCGAGTATGGCTTCTTAGCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-102s1c1
Sequence:CCGGCCAAGTATATTAGGAACCGTACTCGAGTACGGTTCCTAATATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-1669s21c1
Sequence:CCGGCCTTGTCTTGTTCTCTCTCAACTCGAGTTGAGAGAGAACAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-297s21c1
Sequence:CCGGCCTTCAACATGGACGAGTATGCTCGAGCATACTCGTCCATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011937.2-243s21c1
Sequence:CCGGAGAAGCTGATCGAGTACTATACTCGAGTATAGTACTCGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-817s21c1
Sequence:CCGGGGACGCCACCTTGGAACTAAACTCGAGTTTAGTTCCAAGGTGGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-180s21c1
Sequence:CCGGCAGGGCCTGACAAGTACTTCACTCGAGTGAAGTACTTGTCAGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011937
VALIDATED
GNPDA1 MISSION shRNA shRNA Plasmid DNA
glucosamine-6-phosphate deaminase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011937.1-1625s1c1
Sequence:CCGGCCTTGTCTTGTTCTCTCTCAACTCGAGTTGAGAGAGAACAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-113s1c1
Sequence:CCGGAGGAACCGTATCATCCAGTTTCTCGAGAAACTGGATGATACGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-307s1c1
Sequence:CCGGCCACTTCTTCATGTGGGATAACTCGAGTTATCCCACATGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-892s1c1
Sequence:CCGGCCAATCTGCTAAGAAGCCATACTCGAGTATGGCTTCTTAGCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-102s1c1
Sequence:CCGGCCAAGTATATTAGGAACCGTACTCGAGTACGGTTCCTAATATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-1669s21c1
Sequence:CCGGCCTTGTCTTGTTCTCTCTCAACTCGAGTTGAGAGAGAACAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-297s21c1
Sequence:CCGGCCTTCAACATGGACGAGTATGCTCGAGCATACTCGTCCATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011937.2-243s21c1
Sequence:CCGGAGAAGCTGATCGAGTACTATACTCGAGTATAGTACTCGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-817s21c1
Sequence:CCGGGGACGCCACCTTGGAACTAAACTCGAGTTTAGTTCCAAGGTGGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-180s21c1
Sequence:CCGGCAGGGCCTGACAAGTACTTCACTCGAGTGAAGTACTTGTCAGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011937
VALIDATED
GNPDA1 MISSION shRNA Lentiviral Transduction Particles
glucosamine-6-phosphate deaminase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011937.1-1625s1c1
Sequence:CCGGCCTTGTCTTGTTCTCTCTCAACTCGAGTTGAGAGAGAACAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-113s1c1
Sequence:CCGGAGGAACCGTATCATCCAGTTTCTCGAGAAACTGGATGATACGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-307s1c1
Sequence:CCGGCCACTTCTTCATGTGGGATAACTCGAGTTATCCCACATGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-892s1c1
Sequence:CCGGCCAATCTGCTAAGAAGCCATACTCGAGTATGGCTTCTTAGCAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011937.1-102s1c1
Sequence:CCGGCCAAGTATATTAGGAACCGTACTCGAGTACGGTTCCTAATATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-1669s21c1
Sequence:CCGGCCTTGTCTTGTTCTCTCTCAACTCGAGTTGAGAGAGAACAAGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-297s21c1
Sequence:CCGGCCTTCAACATGGACGAGTATGCTCGAGCATACTCGTCCATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011937.2-243s21c1
Sequence:CCGGAGAAGCTGATCGAGTACTATACTCGAGTATAGTACTCGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-817s21c1
Sequence:CCGGGGACGCCACCTTGGAACTAAACTCGAGTTTAGTTCCAAGGTGGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011937.2-180s21c1
Sequence:CCGGCAGGGCCTGACAAGTACTTCACTCGAGTGAAGTACTTGTCAGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks