EMAIL THIS PAGE TO A FRIEND

GNPDA2

glucosamine-6-phosphate deaminase 2

77 Gene Product Result for
Synonyms: GNP2 SB52
Gene ID:
Human(132789) Summary: The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Mouse(67980) glucosamine-6-phosphate deaminase 2
Rat(289608) glucosamine-6-phosphate deaminase 2
domestic guinea pig(100720530) glucosamine-6-phosphate deaminase 2
naked mole-rat(101722427) glucosamine-6-phosphate deaminase 2
sheep(101120577) glucosamine-6-phosphate deaminase 2
Zebrafish(556291) glucosamine-6-phosphate deaminase 2
cow(508383) glucosamine-6-phosphate deaminase 2
domestic cat(101099377) glucosamine-6-phosphate deaminase 2
dog(608049) glucosamine-6-phosphate deaminase 2
chicken(422772) glucosamine-6-phosphate deaminase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138335 Rosetta Predictions human pricing
NM_001106005 Rosetta Predictions rat pricing
NM_001038015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363425 predicted 1033
2 SASI_Hs01_00110990 predicted 746
3 SASI_Hs01_00110991 predicted 770
4 SASI_Hs01_00110992 predicted 209
5 SASI_Hs01_00110993 predicted 700
6 SASI_Hs01_00110994 predicted 366
7 SASI_Hs01_00110995 predicted 460
8 SASI_Hs01_00110997 predicted 284
9 SASI_Hs02_00363426 predicted 742
10 SASI_Hs01_00110998 predicted 440
11 SASI_Hs01_00110989 predicted 779
12 SASI_Hs01_00110996 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214692 predicted 334
2 SASI_Rn02_00214693 predicted 253
3 SASI_Rn02_00214694 predicted 580
4 SASI_Rn02_00214695 predicted 335
5 SASI_Rn02_00214696 predicted 570
6 SASI_Rn02_00214697 predicted 594
7 SASI_Rn02_00214698 predicted 402
8 SASI_Rn02_00214699 predicted 431
9 SASI_Rn02_00214700 predicted 376
10 SASI_Rn02_00214701 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101907 predicted 346
2 SASI_Mm01_00101908 predicted 805
3 SASI_Mm01_00101909 predicted 584
4 SASI_Mm01_00101910 predicted 405
5 SASI_Mm01_00101911 predicted 567
6 SASI_Mm01_00101912 predicted 380
7 SASI_Mm01_00101913 predicted 377
8 SASI_Mm01_00101914 predicted 329
9 SASI_Mm01_00101915 predicted 279
10 SASI_Mm02_00289582 predicted 360
11 SASI_Mm01_00101906 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138335
VALIDATED
GNPDA2 MISSION shRNA Bacterial Glycerol Stock
glucosamine-6-phosphate deaminase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-1185s21c1
Sequence:CCGGTCAAGATTGACTGGCTATTTACTCGAGTAAATAGCCAGTCAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-213s21c1
Sequence:CCGGACATCTGTAATCGCATCATTCCTCGAGGAATGATGCGATTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-241s21c1
Sequence:CCGGACCTGGACAGGACAGATATTTCTCGAGAAATATCTGTCCTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-1314s21c1
Sequence:CCGGTATGACTCCAGTGGCATATATCTCGAGATATATGCCACTGGAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138335.1-443s21c1
Sequence:CCGGCATATCGATATAGATCCTAATCTCGAGATTAGGATCTATATCGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-480s21c1
Sequence:CCGGACGGGAATGCTGCAGATTTACCTCGAGGTAAATCTGCAGCATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-287s21c1
Sequence:CCGGACACCTTTAGGATGCTATAAACTCGAGTTTATAGCATCCTAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-872s21c1
Sequence:CCGGTGCGATGAAGATGCTACTTTACTCGAGTAAAGTAGCATCTTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-467s1c1
Sequence:CCGGGCACATATCCTTGACGGGAATCTCGAGATTCCCGTCAAGGATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138335.1-285s1c1
Sequence:CCGGGTACACCTTTAGGATGCTATACTCGAGTATAGCATCCTAAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-386s1c1
Sequence:CCGGCTTCCAAGAAATCATCCTGAACTCGAGTTCAGGATGATTTCTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-578s1c1
Sequence:CCGGGATGGTCATATCGCTTTCAATCTCGAGATTGAAAGCGATATGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-788s1c1
Sequence:CCGGGCCCTGTACAAAGCAATAGAACTCGAGTTCTATTGCTTTGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138335
VALIDATED
GNPDA2 MISSION shRNA shRNA Plasmid DNA
glucosamine-6-phosphate deaminase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-1185s21c1
Sequence:CCGGTCAAGATTGACTGGCTATTTACTCGAGTAAATAGCCAGTCAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-213s21c1
Sequence:CCGGACATCTGTAATCGCATCATTCCTCGAGGAATGATGCGATTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-241s21c1
Sequence:CCGGACCTGGACAGGACAGATATTTCTCGAGAAATATCTGTCCTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-1314s21c1
Sequence:CCGGTATGACTCCAGTGGCATATATCTCGAGATATATGCCACTGGAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138335.1-443s21c1
Sequence:CCGGCATATCGATATAGATCCTAATCTCGAGATTAGGATCTATATCGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-480s21c1
Sequence:CCGGACGGGAATGCTGCAGATTTACCTCGAGGTAAATCTGCAGCATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-287s21c1
Sequence:CCGGACACCTTTAGGATGCTATAAACTCGAGTTTATAGCATCCTAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-872s21c1
Sequence:CCGGTGCGATGAAGATGCTACTTTACTCGAGTAAAGTAGCATCTTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-467s1c1
Sequence:CCGGGCACATATCCTTGACGGGAATCTCGAGATTCCCGTCAAGGATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138335.1-285s1c1
Sequence:CCGGGTACACCTTTAGGATGCTATACTCGAGTATAGCATCCTAAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-386s1c1
Sequence:CCGGCTTCCAAGAAATCATCCTGAACTCGAGTTCAGGATGATTTCTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-578s1c1
Sequence:CCGGGATGGTCATATCGCTTTCAATCTCGAGATTGAAAGCGATATGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-788s1c1
Sequence:CCGGGCCCTGTACAAAGCAATAGAACTCGAGTTCTATTGCTTTGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138335
VALIDATED
GNPDA2 MISSION shRNA Lentiviral Transduction Particles
glucosamine-6-phosphate deaminase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-1185s21c1
Sequence:CCGGTCAAGATTGACTGGCTATTTACTCGAGTAAATAGCCAGTCAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-213s21c1
Sequence:CCGGACATCTGTAATCGCATCATTCCTCGAGGAATGATGCGATTACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-241s21c1
Sequence:CCGGACCTGGACAGGACAGATATTTCTCGAGAAATATCTGTCCTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-1314s21c1
Sequence:CCGGTATGACTCCAGTGGCATATATCTCGAGATATATGCCACTGGAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138335.1-443s21c1
Sequence:CCGGCATATCGATATAGATCCTAATCTCGAGATTAGGATCTATATCGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-480s21c1
Sequence:CCGGACGGGAATGCTGCAGATTTACCTCGAGGTAAATCTGCAGCATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-287s21c1
Sequence:CCGGACACCTTTAGGATGCTATAAACTCGAGTTTATAGCATCCTAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138335.1-872s21c1
Sequence:CCGGTGCGATGAAGATGCTACTTTACTCGAGTAAAGTAGCATCTTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-467s1c1
Sequence:CCGGGCACATATCCTTGACGGGAATCTCGAGATTCCCGTCAAGGATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138335.1-285s1c1
Sequence:CCGGGTACACCTTTAGGATGCTATACTCGAGTATAGCATCCTAAAGGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-386s1c1
Sequence:CCGGCTTCCAAGAAATCATCCTGAACTCGAGTTCAGGATGATTTCTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-578s1c1
Sequence:CCGGGATGGTCATATCGCTTTCAATCTCGAGATTGAAAGCGATATGACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138335.1-788s1c1
Sequence:CCGGGCCCTGTACAAAGCAATAGAACTCGAGTTCTATTGCTTTGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027681
VALIDATED
GNPDA2 MISSION shRNA Bacterial Glycerol Stock
glucosamine-6-phosphate deaminase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-1013s1c1
Sequence:CCGGGCTCCGAAGAACCTTTCCATACTCGAGTATGGAAAGGTTCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027681.1-221s1c1
Sequence:CCGGGCCAAGTACATCTGCAATCGTCTCGAGACGATTGCAGATGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-648s1c1
Sequence:CCGGCGCTAGCAATGGACACCATTTCTCGAGAAATGGTGTCCATTGCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027681.1-416s1c1
Sequence:CCGGCCTGAAAGTTACCATTCTTATCTCGAGATAAGAATGGTAACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-218s1c1
Sequence:CCGGGCAGCCAAGTACATCTGCAATCTCGAGATTGCAGATGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027681
VALIDATED
GNPDA2 MISSION shRNA shRNA Plasmid DNA
glucosamine-6-phosphate deaminase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-1013s1c1
Sequence:CCGGGCTCCGAAGAACCTTTCCATACTCGAGTATGGAAAGGTTCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027681.1-221s1c1
Sequence:CCGGGCCAAGTACATCTGCAATCGTCTCGAGACGATTGCAGATGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-648s1c1
Sequence:CCGGCGCTAGCAATGGACACCATTTCTCGAGAAATGGTGTCCATTGCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027681.1-416s1c1
Sequence:CCGGCCTGAAAGTTACCATTCTTATCTCGAGATAAGAATGGTAACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-218s1c1
Sequence:CCGGGCAGCCAAGTACATCTGCAATCTCGAGATTGCAGATGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027681
VALIDATED
GNPDA2 MISSION shRNA Lentiviral Transduction Particles
glucosamine-6-phosphate deaminase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-1013s1c1
Sequence:CCGGGCTCCGAAGAACCTTTCCATACTCGAGTATGGAAAGGTTCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027681.1-221s1c1
Sequence:CCGGGCCAAGTACATCTGCAATCGTCTCGAGACGATTGCAGATGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-648s1c1
Sequence:CCGGCGCTAGCAATGGACACCATTTCTCGAGAAATGGTGTCCATTGCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027681.1-416s1c1
Sequence:CCGGCCTGAAAGTTACCATTCTTATCTCGAGATAAGAATGGTAACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027681.1-218s1c1
Sequence:CCGGGCAGCCAAGTACATCTGCAATCTCGAGATTGCAGATGTACTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks