EMAIL THIS PAGE TO A FRIEND

GNPNAT1

glucosamine-phosphate N-acetyltransferase 1

68 Gene Product Result for
Synonyms: GNPNAT Gpnat1
UniProtKB ID: Q96EK6
Gene ID:
Mouse(54342) glucosamine-phosphate N-acetyltransferase 1
Rat(498486) glucosamine-phosphate N-acetyltransferase 1
Zebrafish(554143) glucosamine-phosphate N-acetyltransferase 1
domestic cat(101099305) glucosamine-phosphate N-acetyltransferase 1
dog(480325) glucosamine-phosphate N-acetyltransferase 1
cow(512299) glucosamine-phosphate N-acetyltransferase 1
chicken(423588) glucosamine-phosphate N-acetyltransferase 1
sheep(101115460) glucosamine-phosphate N-acetyltransferase 1
domestic guinea pig(100731298) glucosamine-phosphate N-acetyltransferase 1
naked mole-rat(101715482) glucosamine-phosphate N-acetyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198066 Rosetta Predictions human pricing
NM_001134756 Rosetta Predictions rat pricing
NM_001134757 Rosetta Predictions rat pricing
NM_019425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041497 predicted 692
2 SASI_Hs01_00041498 predicted 700
3 SASI_Hs01_00041499 predicted 631
4 SASI_Hs01_00041501 predicted 550
5 SASI_Hs01_00041502 predicted 665
6 SASI_Hs01_00041503 predicted 531
7 SASI_Hs01_00041504 predicted 413
8 SASI_Hs01_00041505 predicted 773
9 SASI_Hs01_00041506 predicted 537
10 SASI_Hs02_00371621 predicted 848
11 SASI_Hs01_00041500 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258394 predicted 377
2 SASI_Rn02_00258395 predicted 696
3 SASI_Rn02_00258396 predicted 515
4 SASI_Rn02_00258397 predicted 641
5 SASI_Rn02_00258398 predicted 711
6 SASI_Rn02_00258399 predicted 533
7 SASI_Rn02_00258400 predicted 652
8 SASI_Rn02_00258401 predicted 334
9 SASI_Rn02_00258402 predicted 282
10 SASI_Rn02_00258403 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258404 predicted 391
2 SASI_Rn02_00258405 predicted 699
3 SASI_Rn02_00258406 predicted 521
4 SASI_Rn02_00258407 predicted 651
5 SASI_Rn02_00258408 predicted 709
6 SASI_Rn02_00258409 predicted 539
7 SASI_Rn02_00258410 predicted 663
8 SASI_Rn02_00258411 predicted 340
9 SASI_Rn02_00258412 predicted 288
10 SASI_Rn02_00258413 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195461 predicted 363
2 SASI_Mm01_00195462 predicted 859
3 SASI_Mm01_00195463 predicted 624
4 SASI_Mm01_00195464 predicted 220
5 SASI_Mm01_00195465 predicted 299
6 SASI_Mm01_00195466 predicted 640
7 SASI_Mm01_00195467 predicted 364
8 SASI_Mm01_00195468 predicted 475
9 SASI_Mm01_00195469 predicted 560
10 SASI_Mm01_00195470 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019425
GNPNAT1 MISSION shRNA Bacterial Glycerol Stock
glucosamine-phosphate N-acetyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019425.1-1257s1c1
Sequence:CCGGCCATTGACATTTGAAGCCTTTCTCGAGAAAGGCTTCAAATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-416s1c1
Sequence:CCGGGAGTAGAAGATGTCGTCGTTACTCGAGTAACGACGACATCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-266s1c1
Sequence:CCGGCGGAACAGTTCATGAAATCTTCTCGAGAAGATTTCATGAACTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-120s1c1
Sequence:CCGGGAGTCAGAATACAGCTATATTCTCGAGAATATAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-364s1c1
Sequence:CCGGGCAACTCTGATAATAGAACATCTCGAGATGTTCTATTATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-364s21c1
Sequence:CCGGGCAACTCTGATAATAGAACATCTCGAGATGTTCTATTATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-416s21c1
Sequence:CCGGGAGTAGAAGATGTCGTCGTTACTCGAGTAACGACGACATCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-120s21c1
Sequence:CCGGGAGTCAGAATACAGCTATATTCTCGAGAATATAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-266s21c1
Sequence:CCGGCGGAACAGTTCATGAAATCTTCTCGAGAAGATTTCATGAACTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019425.2-1257s21c1
Sequence:CCGGCCATTGACATTTGAAGCCTTTCTCGAGAAAGGCTTCAAATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019425
GNPNAT1 MISSION shRNA shRNA Plasmid DNA
glucosamine-phosphate N-acetyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019425.1-1257s1c1
Sequence:CCGGCCATTGACATTTGAAGCCTTTCTCGAGAAAGGCTTCAAATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-416s1c1
Sequence:CCGGGAGTAGAAGATGTCGTCGTTACTCGAGTAACGACGACATCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-266s1c1
Sequence:CCGGCGGAACAGTTCATGAAATCTTCTCGAGAAGATTTCATGAACTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-120s1c1
Sequence:CCGGGAGTCAGAATACAGCTATATTCTCGAGAATATAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-364s1c1
Sequence:CCGGGCAACTCTGATAATAGAACATCTCGAGATGTTCTATTATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-364s21c1
Sequence:CCGGGCAACTCTGATAATAGAACATCTCGAGATGTTCTATTATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-416s21c1
Sequence:CCGGGAGTAGAAGATGTCGTCGTTACTCGAGTAACGACGACATCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-120s21c1
Sequence:CCGGGAGTCAGAATACAGCTATATTCTCGAGAATATAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-266s21c1
Sequence:CCGGCGGAACAGTTCATGAAATCTTCTCGAGAAGATTTCATGAACTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019425.2-1257s21c1
Sequence:CCGGCCATTGACATTTGAAGCCTTTCTCGAGAAAGGCTTCAAATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019425
GNPNAT1 MISSION shRNA Lentiviral Transduction Particles
glucosamine-phosphate N-acetyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114591    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019425.1-1257s1c1
Sequence:CCGGCCATTGACATTTGAAGCCTTTCTCGAGAAAGGCTTCAAATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-416s1c1
Sequence:CCGGGAGTAGAAGATGTCGTCGTTACTCGAGTAACGACGACATCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-266s1c1
Sequence:CCGGCGGAACAGTTCATGAAATCTTCTCGAGAAGATTTCATGAACTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-120s1c1
Sequence:CCGGGAGTCAGAATACAGCTATATTCTCGAGAATATAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019425.1-364s1c1
Sequence:CCGGGCAACTCTGATAATAGAACATCTCGAGATGTTCTATTATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-364s21c1
Sequence:CCGGGCAACTCTGATAATAGAACATCTCGAGATGTTCTATTATCAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-416s21c1
Sequence:CCGGGAGTAGAAGATGTCGTCGTTACTCGAGTAACGACGACATCTTCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-120s21c1
Sequence:CCGGGAGTCAGAATACAGCTATATTCTCGAGAATATAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019425.2-266s21c1
Sequence:CCGGCGGAACAGTTCATGAAATCTTCTCGAGAAGATTTCATGAACTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019425.2-1257s21c1
Sequence:CCGGCCATTGACATTTGAAGCCTTTCTCGAGAAAGGCTTCAAATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198066
VALIDATED
GNPNAT1 MISSION shRNA Bacterial Glycerol Stock
glucosamine-phosphate N-acetyltransferase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-452s1c1
Sequence:CCGGGCCCTGAACAATTTATGAAATCTCGAGATTTCATAAATTGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198066.2-536s1c1
Sequence:CCGGGACAGATTGTTGCTACGGCAACTCGAGTTGCCGTAGCAACAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-701s1c1
Sequence:CCGGGTTACAAGATTACCCTTGAATCTCGAGATTCAAGGGTAATCTTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-309s1c1
Sequence:CCGGGAGTCAGAATACAGCTACATTCTCGAGAATGTAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-713s1c1
Sequence:CCGGCCCTTGAATGTCTACCACAAACTCGAGTTTGTGGTAGACATTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-607s21c1
Sequence:CCGGAGAGTAGAAGATGTTGTTGTTCTCGAGAACAACAACATCTTCTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-571s21c1
Sequence:CCGGGAACATAAATTCATCCATTCCCTCGAGGGAATGGATGAATTTATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-393s21c1
Sequence:CCGGTGCTGACTTAAATAGAGGTTTCTCGAGAAACCTCTATTTAAGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-281s21c1
Sequence:CCGGTTGACCCAAGTCTACTCAAAGCTCGAGCTTTGAGTAGACTTGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-791s21c1
Sequence:CCGGGTCGGAGGTTTCTAAAGTAAACTCGAGTTTACTTTAGAAACCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198066.3-1268s21c1
Sequence:CCGGATTAAGTCAGGGTGGATAAATCTCGAGATTTATCCACCCTGACTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198066.3-1117s21c1
Sequence:CCGGATGGGTAATAAGGAGTTATATCTCGAGATATAACTCCTTATTACCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198066
VALIDATED
GNPNAT1 MISSION shRNA shRNA Plasmid DNA
glucosamine-phosphate N-acetyltransferase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-452s1c1
Sequence:CCGGGCCCTGAACAATTTATGAAATCTCGAGATTTCATAAATTGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198066.2-536s1c1
Sequence:CCGGGACAGATTGTTGCTACGGCAACTCGAGTTGCCGTAGCAACAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-701s1c1
Sequence:CCGGGTTACAAGATTACCCTTGAATCTCGAGATTCAAGGGTAATCTTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-309s1c1
Sequence:CCGGGAGTCAGAATACAGCTACATTCTCGAGAATGTAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-713s1c1
Sequence:CCGGCCCTTGAATGTCTACCACAAACTCGAGTTTGTGGTAGACATTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-607s21c1
Sequence:CCGGAGAGTAGAAGATGTTGTTGTTCTCGAGAACAACAACATCTTCTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-571s21c1
Sequence:CCGGGAACATAAATTCATCCATTCCCTCGAGGGAATGGATGAATTTATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-393s21c1
Sequence:CCGGTGCTGACTTAAATAGAGGTTTCTCGAGAAACCTCTATTTAAGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-281s21c1
Sequence:CCGGTTGACCCAAGTCTACTCAAAGCTCGAGCTTTGAGTAGACTTGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-791s21c1
Sequence:CCGGGTCGGAGGTTTCTAAAGTAAACTCGAGTTTACTTTAGAAACCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198066.3-1268s21c1
Sequence:CCGGATTAAGTCAGGGTGGATAAATCTCGAGATTTATCCACCCTGACTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198066.3-1117s21c1
Sequence:CCGGATGGGTAATAAGGAGTTATATCTCGAGATATAACTCCTTATTACCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198066
VALIDATED
GNPNAT1 MISSION shRNA Lentiviral Transduction Particles
glucosamine-phosphate N-acetyltransferase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-452s1c1
Sequence:CCGGGCCCTGAACAATTTATGAAATCTCGAGATTTCATAAATTGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198066.2-536s1c1
Sequence:CCGGGACAGATTGTTGCTACGGCAACTCGAGTTGCCGTAGCAACAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-701s1c1
Sequence:CCGGGTTACAAGATTACCCTTGAATCTCGAGATTCAAGGGTAATCTTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-309s1c1
Sequence:CCGGGAGTCAGAATACAGCTACATTCTCGAGAATGTAGCTGTATTCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_198066.2-713s1c1
Sequence:CCGGCCCTTGAATGTCTACCACAAACTCGAGTTTGTGGTAGACATTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-607s21c1
Sequence:CCGGAGAGTAGAAGATGTTGTTGTTCTCGAGAACAACAACATCTTCTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-571s21c1
Sequence:CCGGGAACATAAATTCATCCATTCCCTCGAGGGAATGGATGAATTTATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-393s21c1
Sequence:CCGGTGCTGACTTAAATAGAGGTTTCTCGAGAAACCTCTATTTAAGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-281s21c1
Sequence:CCGGTTGACCCAAGTCTACTCAAAGCTCGAGCTTTGAGTAGACTTGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198066.3-791s21c1
Sequence:CCGGGTCGGAGGTTTCTAAAGTAAACTCGAGTTTACTTTAGAAACCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198066.3-1268s21c1
Sequence:CCGGATTAAGTCAGGGTGGATAAATCTCGAGATTTATCCACCCTGACTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198066.3-1117s21c1
Sequence:CCGGATGGGTAATAAGGAGTTATATCTCGAGATATAACTCCTTATTACCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks