EMAIL THIS PAGE TO A FRIEND

GNPTG

N-acetylglucosamine-1-phosphate transferase, gamma subunit

Synonyms: C16orf27 GNPTAG LP2537 RJD9
UniProtKB ID: Q9UJJ9, B2R556, Q6XYD7, Q96L13
Gene ID:
Human(84572) Summary: This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose 6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC, also known as mucolipidosis III gamma.[provided by RefSeq, Feb 2010]
Mouse(214505) N-acetylglucosamine-1-phosphotransferase, gamma subunit
Rat(287134) N-acetylglucosamine-1-phosphate transferase, gamma subunit
Zebrafish(415147) N-acetylglucosamine-1-phosphate transferase, gamma subunit
cow(508713) N-acetylglucosamine-1-phosphate transferase, gamma subunit
domestic cat(101088293) N-acetylglucosamine-1-phosphate transferase, gamma subunit
dog(490078) N-acetylglucosamine-1-phosphate transferase, gamma subunit
chicken(416591) N-acetylglucosamine-1-phosphate transferase, gamma subunit
sheep(101108446) N-acetylglucosamine-1-phosphate transferase, gamma subunit
domestic guinea pig(100723134) N-acetylglucosamine-1-phosphate transferase, gamma subunit
naked mole-rat(101715733) N-acetylglucosamine-1-phosphate transferase, gamma subunit
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032520 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032520 Rosetta Predictions human pricing
NM_001100493 Rosetta Predictions rat pricing
NM_172529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133629 predicted 502
2 SASI_Hs01_00133630 predicted 840
3 SASI_Hs01_00133631 predicted 504
4 SASI_Hs01_00133632 predicted 361
5 SASI_Hs01_00133633 predicted 760
6 SASI_Hs01_00133634 predicted 672
7 SASI_Hs01_00133635 predicted 798
8 SASI_Hs01_00133636 predicted 546
9 SASI_Hs01_00133637 predicted 877
10 SASI_Hs01_00133638 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209884 predicted 801
2 SASI_Rn02_00209885 predicted 233
3 SASI_Rn02_00209886 predicted 760
4 SASI_Rn02_00209887 predicted 726
5 SASI_Rn02_00209888 predicted 433
6 SASI_Rn02_00209889 predicted 237
7 SASI_Rn02_00209890 predicted 483
8 SASI_Rn02_00209891 predicted 215
9 SASI_Rn02_00209892 predicted 468
10 SASI_Rn02_00209893 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087813 predicted 324
2 SASI_Mm01_00087814 predicted 193
3 SASI_Mm01_00087815 predicted 223
4 SASI_Mm01_00087816 predicted 418
5 SASI_Mm01_00087817 predicted 354
6 SASI_Mm02_00344138 predicted 776
7 SASI_Mm01_00087818 predicted 597
8 SASI_Mm01_00087819 predicted 755
9 SASI_Mm01_00087820 predicted 604
10 SASI_Mm02_00344139 predicted 230
11 SASI_Mm01_00087812 predicted 808
12 SASI_Mm01_00087821 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172529
GNPTG MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine-1-phosphate transferase, gamma subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172529.2-1077s1c1
Sequence:CCGGGCCTTTGTTGTGCCCAAAGATCTCGAGATCTTTGGGCACAACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-102s1c1
Sequence:CCGGCCTAACACATTCGGGCTGAATCTCGAGATTCAGCCCGAATGTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-233s1c1
Sequence:CCGGGTCCACGTACAAGTATGAATTCTCGAGAATTCATACTTGTACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-472s1c1
Sequence:CCGGCCTGTGTCTATGCATTGACATCTCGAGATGTCAATGCATAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-333s1c1
Sequence:CCGGGAGTGGGAAATCATCAACAATCTCGAGATTGTTGATGATTTCCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172529
GNPTG MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine-1-phosphate transferase, gamma subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172529.2-1077s1c1
Sequence:CCGGGCCTTTGTTGTGCCCAAAGATCTCGAGATCTTTGGGCACAACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-102s1c1
Sequence:CCGGCCTAACACATTCGGGCTGAATCTCGAGATTCAGCCCGAATGTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-233s1c1
Sequence:CCGGGTCCACGTACAAGTATGAATTCTCGAGAATTCATACTTGTACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-472s1c1
Sequence:CCGGCCTGTGTCTATGCATTGACATCTCGAGATGTCAATGCATAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-333s1c1
Sequence:CCGGGAGTGGGAAATCATCAACAATCTCGAGATTGTTGATGATTTCCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172529
GNPTG MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine-1-phosphate transferase, gamma subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172529.2-1077s1c1
Sequence:CCGGGCCTTTGTTGTGCCCAAAGATCTCGAGATCTTTGGGCACAACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-102s1c1
Sequence:CCGGCCTAACACATTCGGGCTGAATCTCGAGATTCAGCCCGAATGTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-233s1c1
Sequence:CCGGGTCCACGTACAAGTATGAATTCTCGAGAATTCATACTTGTACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-472s1c1
Sequence:CCGGCCTGTGTCTATGCATTGACATCTCGAGATGTCAATGCATAGACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172529.2-333s1c1
Sequence:CCGGGAGTGGGAAATCATCAACAATCTCGAGATTGTTGATGATTTCCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032520
VALIDATED
GNPTG MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine-1-phosphate transferase, gamma subunit
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-362s1c1
Sequence:CCGGCGAGTGGGAGATCGCCAACAACTCGAGTTGTTGGCGATCTCCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-272s1c1
Sequence:CCGGCAAGTATGAGTTCTGCCCGTTCTCGAGAACGGGCAGAACTCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-851s1c1
Sequence:CCGGGCCCACAGAAACTTCCAACTTCTCGAGAAGTTGGAAGTTTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-786s1c1
Sequence:CCGGGAACTCTCAAAGGAGATCAAACTCGAGTTTGATCTCCTTTGAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032520.4-708s21c1
Sequence:CCGGAGGATGCTGGCTACTTAAAGACTCGAGTCTTTAAGTAGCCAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032520.4-582s21c1
Sequence:CCGGACGCCTTGCTAGTGTACCCAACTCGAGTTGGGTACACTAGCAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032520.4-1076s21c1
Sequence:CCGGGTGCTCAGAGAAGCAGACAAACTCGAGTTTGTCTGCTTCTCTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032520
VALIDATED
GNPTG MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine-1-phosphate transferase, gamma subunit
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-362s1c1
Sequence:CCGGCGAGTGGGAGATCGCCAACAACTCGAGTTGTTGGCGATCTCCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-272s1c1
Sequence:CCGGCAAGTATGAGTTCTGCCCGTTCTCGAGAACGGGCAGAACTCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-851s1c1
Sequence:CCGGGCCCACAGAAACTTCCAACTTCTCGAGAAGTTGGAAGTTTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-786s1c1
Sequence:CCGGGAACTCTCAAAGGAGATCAAACTCGAGTTTGATCTCCTTTGAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032520.4-708s21c1
Sequence:CCGGAGGATGCTGGCTACTTAAAGACTCGAGTCTTTAAGTAGCCAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032520.4-582s21c1
Sequence:CCGGACGCCTTGCTAGTGTACCCAACTCGAGTTGGGTACACTAGCAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032520.4-1076s21c1
Sequence:CCGGGTGCTCAGAGAAGCAGACAAACTCGAGTTTGTCTGCTTCTCTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032520
VALIDATED
GNPTG MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine-1-phosphate transferase, gamma subunit
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-362s1c1
Sequence:CCGGCGAGTGGGAGATCGCCAACAACTCGAGTTGTTGGCGATCTCCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-272s1c1
Sequence:CCGGCAAGTATGAGTTCTGCCCGTTCTCGAGAACGGGCAGAACTCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-851s1c1
Sequence:CCGGGCCCACAGAAACTTCCAACTTCTCGAGAAGTTGGAAGTTTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032520.3-786s1c1
Sequence:CCGGGAACTCTCAAAGGAGATCAAACTCGAGTTTGATCTCCTTTGAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032520.4-708s21c1
Sequence:CCGGAGGATGCTGGCTACTTAAAGACTCGAGTCTTTAAGTAGCCAGCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032520.4-582s21c1
Sequence:CCGGACGCCTTGCTAGTGTACCCAACTCGAGTTGGGTACACTAGCAAGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032520.4-1076s21c1
Sequence:CCGGGTGCTCAGAGAAGCAGACAAACTCGAGTTTGTCTGCTTCTCTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks