EMAIL THIS PAGE TO A FRIEND

GNRH1

gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)

105 Gene Product Result for
Synonyms: GNRH GRH HH12 LHRH LNRH
UniProtKB ID: P01148, A0AVP0
Gene ID:
Human(2796) Summary: The protein encoded by this gene is secreted and then cleaved to form the 10 aa luteinizing hormone-releasing hormone (LHRH, also known as gonadoliberin-1), and prolactin release-inhibiting factor (also known as GnRH-associated peptide 1). LHRH stimulates the release of luteinizing and follicle stimulating hormones, which are important for reproduction. Mutation in this gene are associated with hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2012]
Mouse(14714) gonadotropin releasing hormone 1
Rat(25194) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
domestic guinea pig(100135531) gonadotropin releasing hormone 1
naked mole-rat(101705387) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
sheep(101111690) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
sheep(443529) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
chicken(770134) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
dog(608671) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
cow(768325) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
domestic cat(101080783) gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
A5667 Asp-Ala-Glu-Asn-Leu-Ile-Asp-Ser-Phe-Gln-Glu-Ile-Val ≥97% (HPLC) human pricing
L1898 [D-Ala6]-LH-RH acetate salt hydrate ≥97% (HPLC) human pricing
L4663 [D-Ser4]-LH-RH >97% (HPLC) human pricing
L9761 [D-Trp6]-LH-RH ≥97% (HPLC), powder human pricing
L4788 [D-Trp6]-LH-RH-Leu-Arg-Pro-Gly-NH2 ≥96% (HPLC) human pricing
L4913 [His(3-Methyl)2]-LH-RH >96% (HPLC) human pricing
L7134 Luteinizing hormone releasing hormone human acetate salt ≥98% (HPLC), powder human pricing
APREST85924 PrEST Antigen GNRH1 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22473 SILuPrEST GON1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
L4413 [D-His(Bzl)6]-LH-RH Fragment 2-9 >99% (HPLC) human, mouse, rat pricing
L3413 [D-His(Bzl)6]-LH-RH Fragment 4-9 ethylamide trifluoroacetate salt >95% (HPLC) human, mouse, rat pricing
L3288 [D-His(Bzl)6]-LH-RH Fragment 5-9 Ethylamide trifluoroacetate salt >98% (HPLC) human, mouse, rat pricing
L2761 [des-Gly10, D-His(Bzl)6]-LH-RH ethylamide ≥97% (HPLC), powder human, mouse, rat pricing
L4163 [des-Gly10, D-His2, D-Trp6, Pro9]-LH-RH ethylamide trifluoroacetate salt >98% (HPLC) human, mouse, rat pricing
L3663 [des-Gly10, D-Ser4, D-His(Bzl)6, Pro9]-LH-RH ethylamide acetate salt >96% (HPLC) human, mouse, rat pricing
L4038 [des-Gly10, D-Ser4, D-Trp6, Pro9]-LH-RH ethylamide trifluoroacetate salt >98% (HPLC) human, mouse, rat pricing
L5386 [des-Gly10, D-Trp6]-LH-RH ethylamide ≥97% (HPLC) human, mouse, rat pricing
L3788 [des-Gly10, D-Tyr5, D-Trp6, Pro9]-LH-RH ethylamide trifluoroacetate salt >99% (HPLC) human, mouse, rat pricing
G4919 Goserelin acetate ≥99% (HPLC), white powder human, mouse, rat pricing
L6038 LH-RH Fragment 1-4 >98% (HPLC) human, mouse, rat pricing
L4897 Luteinizing hormone releasing hormone salmon ≥97% (HPLC) human, mouse, rat pricing
L5038 [D-Trp6]-LHRH Fragment, 1-6 >96% (HPLC) mouse pricing
L5413 Formyl-[D-Trp6]-LH-RH Fragment 2-10 >97% (HPLC) mouse pricing
L4513 [des-Gly10, D-Ala6]-LH-RH ethylamide acetate salt hydrate ≥97% (HPLC), powder mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000825 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000825 Rosetta Predictions human pricing
NM_001083111 Rosetta Predictions human pricing
NM_012767 Rosetta Predictions rat pricing
NM_008145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303302 predicted 1918
2 SASI_Hs02_00303303 predicted 2068
3 SASI_Hs02_00303304 predicted 2099
4 SASI_Hs02_00303305 predicted 2017
5 SASI_Hs02_00303306 predicted 2052
6 SASI_Hs02_00303307 predicted 2018
7 SASI_Hs01_00246428 predicted 1887
8 SASI_Hs02_00303308 predicted 1997
9 SASI_Hs02_00303309 predicted 2004
10 SASI_Hs02_00303310 predicted 1992
11 SASI_Hs01_00246427 predicted 1200
12 SASI_Hs01_00246429 predicted 1104
13 SASI_Hs01_00246430 predicted 1237
14 SASI_Hs01_00246431 predicted 1101
15 SASI_Hs01_00246432 predicted 1161
16 SASI_Hs01_00246433 predicted 1094
17 SASI_Hs01_00246434 predicted 1222
18 SASI_Hs01_00246435 predicted 1248
19 SASI_Hs01_00246436 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316844 predicted 1049
2 SASI_Hs02_00316845 predicted 1194
3 SASI_Hs02_00316846 predicted 1230
4 SASI_Hs02_00316847 predicted 1143
5 SASI_Hs02_00316848 predicted 1187
6 SASI_Hs02_00316849 predicted 1156
7 SASI_Hs02_00316850 predicted 1016
8 SASI_Hs02_00316851 predicted 1131
9 SASI_Hs02_00316852 predicted 1136
10 SASI_Hs02_00316853 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083086 predicted 209
2 SASI_Rn01_00083087 predicted 227
3 SASI_Rn01_00083088 predicted 364
4 SASI_Rn01_00083089 predicted 368
5 SASI_Rn01_00083090 predicted 147
6 SASI_Rn01_00083092 predicted 172
7 SASI_Rn01_00083093 predicted 288
8 SASI_Rn01_00083094 predicted 328
9 SASI_Rn01_00083095 predicted 417
10 SASI_Rn02_00260144 predicted 419
11 SASI_Rn01_00083091 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178936 predicted 235
2 SASI_Mm01_00178937 predicted 196
3 SASI_Mm01_00178938 predicted 238
4 SASI_Mm01_00178939 predicted 241
5 SASI_Mm02_00313239 predicted 213
6 SASI_Mm02_00313240 predicted 214
7 SASI_Mm02_00313241 predicted 220
8 SASI_Mm02_00313242 predicted 211
9 SASI_Mm02_00313243 predicted 204
10 SASI_Mm02_00313244 predicted 269
11 SASI_Mm01_00178935 predicted 224
12 SASI_Mm01_00178940 predicted 21
13 SASI_Mm01_00178941 predicted 26
14 SASI_Mm01_00178942 predicted 19
15 SASI_Mm01_00178943 predicted 58
16 SASI_Mm01_00178944 predicted 31
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000825
GNRH1 MISSION shRNA Bacterial Glycerol Stock
gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000825.3-1987s21c1
Sequence:CCGGTAAATCCATTGGGCCAGAAGGCTCGAGCCTTCTGGCCCAATGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000825.3-1878s21c1
Sequence:CCGGAGAAACCCAACGCTTCGAATGCTCGAGCATTCGAAGCGTTGGGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1306s1c1
Sequence:CCGGGCTCTGGAAAGTCTGATTGAACTCGAGTTCAATCAGACTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1312s1c1
Sequence:CCGGGAAAGTCTGATTGAAGAGGAACTCGAGTTCCTCTTCAATCAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1204s1c1
Sequence:CCGGTCTTTCCAAGAGATAGTCAAACTCGAGTTTGACTATCTCTTGGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1210s1c1
Sequence:CCGGCAAGAGATAGTCAAAGAGGTTCTCGAGAACCTCTTTGACTATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1226s1c1
Sequence:CCGGAGGTTGGTCAACTGGCAGAAACTCGAGTTTCTGCCAGTTGACCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000825
GNRH1 MISSION shRNA shRNA Plasmid DNA
gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000825.3-1987s21c1
Sequence:CCGGTAAATCCATTGGGCCAGAAGGCTCGAGCCTTCTGGCCCAATGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000825.3-1878s21c1
Sequence:CCGGAGAAACCCAACGCTTCGAATGCTCGAGCATTCGAAGCGTTGGGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1306s1c1
Sequence:CCGGGCTCTGGAAAGTCTGATTGAACTCGAGTTCAATCAGACTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1312s1c1
Sequence:CCGGGAAAGTCTGATTGAAGAGGAACTCGAGTTCCTCTTCAATCAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1204s1c1
Sequence:CCGGTCTTTCCAAGAGATAGTCAAACTCGAGTTTGACTATCTCTTGGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1210s1c1
Sequence:CCGGCAAGAGATAGTCAAAGAGGTTCTCGAGAACCTCTTTGACTATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1226s1c1
Sequence:CCGGAGGTTGGTCAACTGGCAGAAACTCGAGTTTCTGCCAGTTGACCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000825
GNRH1 MISSION shRNA Lentiviral Transduction Particles
gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000825.3-1987s21c1
Sequence:CCGGTAAATCCATTGGGCCAGAAGGCTCGAGCCTTCTGGCCCAATGGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000825.3-1878s21c1
Sequence:CCGGAGAAACCCAACGCTTCGAATGCTCGAGCATTCGAAGCGTTGGGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1306s1c1
Sequence:CCGGGCTCTGGAAAGTCTGATTGAACTCGAGTTCAATCAGACTTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1312s1c1
Sequence:CCGGGAAAGTCTGATTGAAGAGGAACTCGAGTTCCTCTTCAATCAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1204s1c1
Sequence:CCGGTCTTTCCAAGAGATAGTCAAACTCGAGTTTGACTATCTCTTGGAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1210s1c1
Sequence:CCGGCAAGAGATAGTCAAAGAGGTTCTCGAGAACCTCTTTGACTATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000825.2-1226s1c1
Sequence:CCGGAGGTTGGTCAACTGGCAGAAACTCGAGTTTCTGCCAGTTGACCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008145
GNRH1 MISSION shRNA Bacterial Glycerol Stock
gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-107s1c1
Sequence:CCGGCTGAACACTTGGTTGAGTCTTCTCGAGAAGACTCAACCAAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-63s1c1
Sequence:CCGGCCAGCACTGGTCCTATGGGTTCTCGAGAACCCATAGGACCAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-123s1c1
Sequence:CCGGGTCTTTCCAAGAGATGGGCAACTCGAGTTGCCCATCTCTTGGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-31s1c1
Sequence:CCGGCTGCTGACTGTGTGTTTGGAACTCGAGTTCCAAACACACAGTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-95s1c1
Sequence:CCGGGAAAGAGAAACACTGAACACTCTCGAGAGTGTTCAGTGTTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008145
GNRH1 MISSION shRNA shRNA Plasmid DNA
gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-107s1c1
Sequence:CCGGCTGAACACTTGGTTGAGTCTTCTCGAGAAGACTCAACCAAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-63s1c1
Sequence:CCGGCCAGCACTGGTCCTATGGGTTCTCGAGAACCCATAGGACCAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-123s1c1
Sequence:CCGGGTCTTTCCAAGAGATGGGCAACTCGAGTTGCCCATCTCTTGGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-31s1c1
Sequence:CCGGCTGCTGACTGTGTGTTTGGAACTCGAGTTCCAAACACACAGTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-95s1c1
Sequence:CCGGGAAAGAGAAACACTGAACACTCTCGAGAGTGTTCAGTGTTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008145
GNRH1 MISSION shRNA Lentiviral Transduction Particles
gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-107s1c1
Sequence:CCGGCTGAACACTTGGTTGAGTCTTCTCGAGAAGACTCAACCAAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-63s1c1
Sequence:CCGGCCAGCACTGGTCCTATGGGTTCTCGAGAACCCATAGGACCAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-123s1c1
Sequence:CCGGGTCTTTCCAAGAGATGGGCAACTCGAGTTGCCCATCTCTTGGAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-31s1c1
Sequence:CCGGCTGCTGACTGTGTGTTTGGAACTCGAGTTCCAAACACACAGTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008145.1-95s1c1
Sequence:CCGGGAAAGAGAAACACTGAACACTCTCGAGAGTGTTCAGTGTTTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks