EMAIL THIS PAGE TO A FRIEND

GNRH2

gonadotropin-releasing hormone 2

40 Gene Product Result for
Synonyms: GnRH-II LH-RHII
UniProtKB ID: O43555, Q14C68, Q14C69, Q9BYN9, Q9BYP0
Gene ID:
Human(2797) Summary: The protein encoded by this gene is a preproprotein that is cleaved to form a secreted 10 aa peptide hormone. The secreted decapeptide regulates reproduction in females by stimulating the secretion of both luteinizing- and follicle-stimulating hormones. Three transcript variants that encode unique proproteins but the same peptide hormone have been found for this gene. [provided by RefSeq, Jul 2008]
Zebrafish(353222) gonadotropin-releasing hormone 2
cow(788698) gonadotropin-releasing hormone 2
cow(100848664) gonadotropin-releasing hormone 2
sheep(101112753) gonadotropin-releasing hormone 2
domestic guinea pig(101787136) gonadotropin-releasing hormone 2
naked mole-rat(101717034) gonadotropin-releasing hormone 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001501 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124751 MISSION® esiRNA esiRNA human GNRH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001501 Rosetta Predictions human pricing
NM_178331 Rosetta Predictions human pricing
NM_178332 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144538 predicted 336
2 SASI_Hs01_00144539 predicted 102
3 SASI_Hs01_00144541 predicted 387
4 SASI_Hs01_00144542 predicted 314
5 SASI_Hs02_00331993 predicted 387
6 SASI_Hs01_00144543 predicted 95
7 SASI_Hs01_00144544 predicted 318
8 SASI_Hs01_00144545 predicted 311
9 SASI_Hs01_00144546 predicted 351
10 SASI_Hs01_00144547 predicted 338
11 SASI_Hs01_00144540 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206324 predicted 311
2 SASI_Hs01_00206325 predicted 101
3 SASI_Hs01_00206327 predicted 370
4 SASI_Hs01_00206328 predicted 293
5 SASI_Hs02_00369637 predicted 370
6 SASI_Hs01_00206329 predicted 92
7 SASI_Hs01_00206330 predicted 292
8 SASI_Hs01_00206331 predicted 292
9 SASI_Hs01_00206332 predicted 322
10 SASI_Hs01_00206333 predicted 322
11 SASI_Hs01_00206326 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151622 predicted 307
2 SASI_Hs01_00151623 predicted 100
3 SASI_Hs01_00151625 predicted 359
4 SASI_Hs01_00151626 predicted 284
5 SASI_Hs02_00369638 predicted 359
6 SASI_Hs01_00151627 predicted 98
7 SASI_Hs01_00151628 predicted 294
8 SASI_Hs01_00151629 predicted 285
9 SASI_Hs01_00151630 predicted 326
10 SASI_Hs01_00151631 predicted 312
11 SASI_Hs01_00151624 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001501
GNRH2 MISSION shRNA Bacterial Glycerol Stock
gonadotropin-releasing hormone 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-77s21c1
Sequence:CCGGTGCTCCTGCTGCTGCTGACTGCTCGAGCAGTCAGCAGCAGCAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-222s21c1
Sequence:CCGGTGCAGCAGGCAGCCCAGTCCACTCGAGTGGACTGGGCTGCCTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-163s21c1
Sequence:CCGGCTCAGCTCAGCCCAGGATCCCCTCGAGGGGATCCTGGGCTGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-105s21c1
Sequence:CCGGTGGACCCTCAGAGGCTCAGCACTCGAGTGCTGAGCCTCTGAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-234s21c1
Sequence:CCGGCCCAGTCCAGACTGCCCATGGCTCGAGCCATGGGCAGTCTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-246s21c1
Sequence:CCGGTGCCCATGGCCTCCCAAGTGACTCGAGTCACTTGGGAGGCCATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-89s21c1
Sequence:CCGGTGCTGACTGCCCACCTTGGACCTCGAGGTCCAAGGTGGGCAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-152s21c1
Sequence:CCGGGAAAGCGAGCCCTCAGCTCAGCTCGAGCTGAGCTGAGGGCTCGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-123s21c1
Sequence:CCGGGCACTGGTCCCATGGCTGGTACTCGAGTACCAGCCATGGGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001501
GNRH2 MISSION shRNA shRNA Plasmid DNA
gonadotropin-releasing hormone 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-77s21c1
Sequence:CCGGTGCTCCTGCTGCTGCTGACTGCTCGAGCAGTCAGCAGCAGCAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-222s21c1
Sequence:CCGGTGCAGCAGGCAGCCCAGTCCACTCGAGTGGACTGGGCTGCCTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-163s21c1
Sequence:CCGGCTCAGCTCAGCCCAGGATCCCCTCGAGGGGATCCTGGGCTGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-105s21c1
Sequence:CCGGTGGACCCTCAGAGGCTCAGCACTCGAGTGCTGAGCCTCTGAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-234s21c1
Sequence:CCGGCCCAGTCCAGACTGCCCATGGCTCGAGCCATGGGCAGTCTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-246s21c1
Sequence:CCGGTGCCCATGGCCTCCCAAGTGACTCGAGTCACTTGGGAGGCCATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-89s21c1
Sequence:CCGGTGCTGACTGCCCACCTTGGACCTCGAGGTCCAAGGTGGGCAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-152s21c1
Sequence:CCGGGAAAGCGAGCCCTCAGCTCAGCTCGAGCTGAGCTGAGGGCTCGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-123s21c1
Sequence:CCGGGCACTGGTCCCATGGCTGGTACTCGAGTACCAGCCATGGGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001501
GNRH2 MISSION shRNA Lentiviral Transduction Particles
gonadotropin-releasing hormone 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-77s21c1
Sequence:CCGGTGCTCCTGCTGCTGCTGACTGCTCGAGCAGTCAGCAGCAGCAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-222s21c1
Sequence:CCGGTGCAGCAGGCAGCCCAGTCCACTCGAGTGGACTGGGCTGCCTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-163s21c1
Sequence:CCGGCTCAGCTCAGCCCAGGATCCCCTCGAGGGGATCCTGGGCTGAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-105s21c1
Sequence:CCGGTGGACCCTCAGAGGCTCAGCACTCGAGTGCTGAGCCTCTGAGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-234s21c1
Sequence:CCGGCCCAGTCCAGACTGCCCATGGCTCGAGCCATGGGCAGTCTGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-246s21c1
Sequence:CCGGTGCCCATGGCCTCCCAAGTGACTCGAGTCACTTGGGAGGCCATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-89s21c1
Sequence:CCGGTGCTGACTGCCCACCTTGGACCTCGAGGTCCAAGGTGGGCAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-152s21c1
Sequence:CCGGGAAAGCGAGCCCTCAGCTCAGCTCGAGCTGAGCTGAGGGCTCGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001501.1-123s21c1
Sequence:CCGGGCACTGGTCCCATGGCTGGTACTCGAGTACCAGCCATGGGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks