EMAIL THIS PAGE TO A FRIEND

GNRHR2

gonadotropin-releasing hormone (type 2) receptor 2

18 Gene Product Result for
Synonyms: GnRH-II-R
UniProtKB ID: Q96P88, E7EN27, Q8TCX8
Gene ID:
Zebrafish(100270671) gonadotropin releasing hormone receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002328 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00375894 predicted 5912
2 SASI_Hs02_00375895 predicted 2606
3 SASI_Hs02_00375896 predicted 2527
4 SASI_Hs02_00375897 predicted 5202
5 SASI_Hs02_00375898 predicted 272
6 SASI_Hs02_00375899 predicted 506
7 SASI_Hs02_00375900 predicted 255
8 SASI_Hs02_00375901 predicted 251
9 SASI_Hs02_00375902 predicted 5045
10 SASI_Hs02_00375903 predicted 5866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057163
VALIDATED
GNRHR2 MISSION shRNA Bacterial Glycerol Stock
gonadotropin-releasing hormone (type 2) receptor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_057163.1-585s1c1
Sequence:CCGGCCTGCTTATCTTGCTGACCTTCTCGAGAAGGTCAGCAAGATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-232s1c1
Sequence:CCGGCGTTCAGGTGTAAGGAAACTTCTCGAGAAGTTTCCTTACACCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_057163.1-141s1c1
Sequence:CCGGCCTGAAACTAATGGCCACGTACTCGAGTACGTGGCCATTAGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-83s1c1
Sequence:CCGGCCTGGAATATCACTGTTCAATCTCGAGATTGAACAGTGATATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-127s1c1
Sequence:CCGGCGGACACTGATGTTCCTGAAACTCGAGTTTCAGGAACATCAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057163
VALIDATED
GNRHR2 MISSION shRNA shRNA Plasmid DNA
gonadotropin-releasing hormone (type 2) receptor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_057163.1-585s1c1
Sequence:CCGGCCTGCTTATCTTGCTGACCTTCTCGAGAAGGTCAGCAAGATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-232s1c1
Sequence:CCGGCGTTCAGGTGTAAGGAAACTTCTCGAGAAGTTTCCTTACACCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_057163.1-141s1c1
Sequence:CCGGCCTGAAACTAATGGCCACGTACTCGAGTACGTGGCCATTAGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-83s1c1
Sequence:CCGGCCTGGAATATCACTGTTCAATCTCGAGATTGAACAGTGATATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-127s1c1
Sequence:CCGGCGGACACTGATGTTCCTGAAACTCGAGTTTCAGGAACATCAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057163
VALIDATED
GNRHR2 MISSION shRNA Lentiviral Transduction Particles
gonadotropin-releasing hormone (type 2) receptor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_057163.1-585s1c1
Sequence:CCGGCCTGCTTATCTTGCTGACCTTCTCGAGAAGGTCAGCAAGATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-232s1c1
Sequence:CCGGCGTTCAGGTGTAAGGAAACTTCTCGAGAAGTTTCCTTACACCTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_057163.1-141s1c1
Sequence:CCGGCCTGAAACTAATGGCCACGTACTCGAGTACGTGGCCATTAGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-83s1c1
Sequence:CCGGCCTGGAATATCACTGTTCAATCTCGAGATTGAACAGTGATATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057163.1-127s1c1
Sequence:CCGGCGGACACTGATGTTCCTGAAACTCGAGTTTCAGGAACATCAGTGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks