EMAIL THIS PAGE TO A FRIEND

GNRHR

gonadotropin-releasing hormone receptor

114 Gene Product Result for
Synonyms: GNRHR1 GRHR HH7 LHRHR LRHR
UniProtKB ID: P30968, O75793, Q14D13, Q92644
Gene ID:
Human(2798) Summary: This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14715) gonadotropin releasing hormone receptor
Rat(81668) gonadotropin releasing hormone receptor
chicken(427517) gonadotropin-releasing hormone receptor
dog(403718) gonadotropin-releasing hormone receptor
cow(281798) gonadotropin-releasing hormone receptor
domestic cat(101088838) gonadotropin-releasing hormone receptor
Horse(100033874) gonadotropin-releasing hormone receptor
domestic guinea pig(100135532) gonadotropin releasing hormone receptor
naked mole-rat(101704341) gonadotropin-releasing hormone receptor
Domestic Rabbit(100009509) gonadotropin-releasing hormone receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
L0399 Leuprolide acetate salt ≥98% (HPLC) human, rat pricing
A8802 Antide ≥97% (HPLC) rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000406 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150031 MISSION® esiRNA esiRNA human GNRHR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000406 Rosetta Predictions human pricing
NM_001012763 Rosetta Predictions human pricing
NM_031038 Rosetta Predictions rat pricing
NM_010323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018714 predicted 2692
2 SASI_Hs01_00018715 predicted 2597
3 SASI_Hs01_00018716 predicted 2655
4 SASI_Hs01_00018717 predicted 2837
5 SASI_Hs01_00018718 predicted 2016
6 SASI_Hs01_00018719 predicted 2803
7 SASI_Hs01_00018720 predicted 2750
8 SASI_Hs01_00018721 predicted 2779
9 SASI_Hs01_00018723 predicted 2693
10 SASI_Hs02_00302488 predicted 2646
11 SASI_Hs01_00018722 predicted 2632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060314 predicted 2471
2 SASI_Hs01_00060315 predicted 2018
3 SASI_Hs01_00060316 predicted 1779
4 SASI_Hs01_00060317 predicted 2675
5 SASI_Hs01_00060318 predicted 2573
6 SASI_Hs01_00060319 predicted 2717
7 SASI_Hs01_00060320 predicted 2629
8 SASI_Hs01_00060321 predicted 2652
9 SASI_Hs01_00060323 predicted 2563
10 SASI_Hs02_00306247 predicted 2510
11 SASI_Hs01_00060322 predicted 2502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264248 predicted 889
2 SASI_Rn02_00264249 predicted 764
3 SASI_Rn02_00264250 predicted 1043
4 SASI_Rn02_00264251 predicted 933
5 SASI_Rn02_00264252 predicted 833
6 SASI_Rn02_00264253 predicted 920
7 SASI_Rn02_00264254 predicted 1096
8 SASI_Rn02_00264255 predicted 815
9 SASI_Rn02_00264256 predicted 604
10 SASI_Rn02_00264257 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043224 predicted 544
2 SASI_Mm01_00043225 predicted 712
3 SASI_Mm01_00043226 predicted 307
4 SASI_Mm01_00043227 predicted 720
5 SASI_Mm01_00043228 predicted 379
6 SASI_Mm01_00043229 predicted 785
7 SASI_Mm01_00043230 predicted 911
8 SASI_Mm02_00318326 predicted 788
9 SASI_Mm01_00043231 predicted 559
10 SASI_Mm01_00043232 predicted 503
11 SASI_Mm01_00043233 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000406
GNRHR MISSION shRNA Bacterial Glycerol Stock
gonadotropin-releasing hormone receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000406.2-3197s21c1
Sequence:CCGGAGAGCCCTTTGCCCATAATATCTCGAGATATTATGGGCAAAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000406.2-2696s21c1
Sequence:CCGGCCCATGCTTTGATCCACTTATCTCGAGATAAGTGGATCAAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000406.2-1860s21c1
Sequence:CCGGATCCGAGTGACGGTTACTTTCCTCGAGGAAAGTAACCGTCACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2063s1c1
Sequence:CCGGCCAATGGTATGCTGGAGAGTTCTCGAGAACTCTCCAGCATACCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-1864s1c1
Sequence:CCGGTGACGGTTACTTTCTTCCTTTCTCGAGAAAGGAAGAAAGTAACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-1894s1c1
Sequence:CCGGCTGCGACCTTTAATGCTTCTTCTCGAGAAGAAGCATTAAAGGTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2047s1c1
Sequence:CCGGTGTGGAACATTACAGTCCAATCTCGAGATTGGACTGTAATGTTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2556s1c1
Sequence:CCGGGTTGCATTTGCCACTTCATTTCTCGAGAAATGAAGTGGCAAATGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000406
GNRHR MISSION shRNA shRNA Plasmid DNA
gonadotropin-releasing hormone receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000406.2-3197s21c1
Sequence:CCGGAGAGCCCTTTGCCCATAATATCTCGAGATATTATGGGCAAAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000406.2-2696s21c1
Sequence:CCGGCCCATGCTTTGATCCACTTATCTCGAGATAAGTGGATCAAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000406.2-1860s21c1
Sequence:CCGGATCCGAGTGACGGTTACTTTCCTCGAGGAAAGTAACCGTCACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2063s1c1
Sequence:CCGGCCAATGGTATGCTGGAGAGTTCTCGAGAACTCTCCAGCATACCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-1864s1c1
Sequence:CCGGTGACGGTTACTTTCTTCCTTTCTCGAGAAAGGAAGAAAGTAACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-1894s1c1
Sequence:CCGGCTGCGACCTTTAATGCTTCTTCTCGAGAAGAAGCATTAAAGGTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2047s1c1
Sequence:CCGGTGTGGAACATTACAGTCCAATCTCGAGATTGGACTGTAATGTTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2556s1c1
Sequence:CCGGGTTGCATTTGCCACTTCATTTCTCGAGAAATGAAGTGGCAAATGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000406
GNRHR MISSION shRNA Lentiviral Transduction Particles
gonadotropin-releasing hormone receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000406.2-3197s21c1
Sequence:CCGGAGAGCCCTTTGCCCATAATATCTCGAGATATTATGGGCAAAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000406.2-2696s21c1
Sequence:CCGGCCCATGCTTTGATCCACTTATCTCGAGATAAGTGGATCAAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000406.2-1860s21c1
Sequence:CCGGATCCGAGTGACGGTTACTTTCCTCGAGGAAAGTAACCGTCACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2063s1c1
Sequence:CCGGCCAATGGTATGCTGGAGAGTTCTCGAGAACTCTCCAGCATACCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-1864s1c1
Sequence:CCGGTGACGGTTACTTTCTTCCTTTCTCGAGAAAGGAAGAAAGTAACCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-1894s1c1
Sequence:CCGGCTGCGACCTTTAATGCTTCTTCTCGAGAAGAAGCATTAAAGGTCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2047s1c1
Sequence:CCGGTGTGGAACATTACAGTCCAATCTCGAGATTGGACTGTAATGTTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000406.1-2556s1c1
Sequence:CCGGGTTGCATTTGCCACTTCATTTCTCGAGAAATGAAGTGGCAAATGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010323
GNRHR MISSION shRNA Bacterial Glycerol Stock
gonadotropin-releasing hormone receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-999s1c1
Sequence:CCGGCCCACTCATATATGGGTATTTCTCGAGAAATACCCATATATGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-778s1c1
Sequence:CCGGCCACGCAAACTACAGCTGAATCTCGAGATTCAGCTGTAGTTTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-183s1c1
Sequence:CCGGCCTACTCTCTACTGCCTTCAACTCGAGTTGAAGGCAGTAGAGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-837s1c1
Sequence:CCGGGCTAAAGATGACAGTCGCATTCTCGAGAATGCGACTGTCATCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-131s1c1
Sequence:CCGGCGACTCTAACCGTATCTGGAACTCGAGTTCCAGATACGGTTAGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010323
GNRHR MISSION shRNA shRNA Plasmid DNA
gonadotropin-releasing hormone receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-999s1c1
Sequence:CCGGCCCACTCATATATGGGTATTTCTCGAGAAATACCCATATATGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-778s1c1
Sequence:CCGGCCACGCAAACTACAGCTGAATCTCGAGATTCAGCTGTAGTTTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-183s1c1
Sequence:CCGGCCTACTCTCTACTGCCTTCAACTCGAGTTGAAGGCAGTAGAGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-837s1c1
Sequence:CCGGGCTAAAGATGACAGTCGCATTCTCGAGAATGCGACTGTCATCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-131s1c1
Sequence:CCGGCGACTCTAACCGTATCTGGAACTCGAGTTCCAGATACGGTTAGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010323
GNRHR MISSION shRNA Lentiviral Transduction Particles
gonadotropin-releasing hormone receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-999s1c1
Sequence:CCGGCCCACTCATATATGGGTATTTCTCGAGAAATACCCATATATGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-778s1c1
Sequence:CCGGCCACGCAAACTACAGCTGAATCTCGAGATTCAGCTGTAGTTTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-183s1c1
Sequence:CCGGCCTACTCTCTACTGCCTTCAACTCGAGTTGAAGGCAGTAGAGAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-837s1c1
Sequence:CCGGGCTAAAGATGACAGTCGCATTCTCGAGAATGCGACTGTCATCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010323.1-131s1c1
Sequence:CCGGCGACTCTAACCGTATCTGGAACTCGAGTTCCAGATACGGTTAGAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks