EMAIL THIS PAGE TO A FRIEND

GOLGA2

golgin A2

118 Gene Product Result for
Synonyms: GM130
UniProtKB ID: Q08379, Q6GRM9, Q9BRB0, Q9NYF9
Gene ID:
Human(2801) Summary: The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Mouse(99412) golgi autoantigen, golgin subfamily a, 2
Rat(64528) golgin A2
Zebrafish(565431) golgi autoantigen, golgin subfamily a, 2
cow(508805) golgin A2
Horse(100067033) golgin A2
dog(480708) golgin A2
chicken(427766) golgi autoantigen, golgin subfamily a, 2
sheep(101108475) golgin A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018141 MISSION® esiRNA esiRNA targeting human GOLGA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004486 Rosetta Predictions human pricing
NM_022596 Rosetta Predictions rat pricing
NM_001080968 Rosetta Predictions mouse pricing
NM_133852 Rosetta Predictions mouse pricing
XM_622099 Rosetta Predictions mouse pricing
XM_893162 Rosetta Predictions mouse pricing
XM_900626 Rosetta Predictions mouse pricing
XM_900636 Rosetta Predictions mouse pricing
XM_900646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200768 predicted 1673
2 SASI_Hs01_00200769 predicted 332
3 SASI_Hs02_00337719 predicted 331
4 SASI_Hs01_00200770 predicted 421
5 SASI_Hs01_00200771 predicted 909
6 SASI_Hs01_00200773 predicted 492
7 SASI_Hs01_00200774 predicted 1258
8 SASI_Hs02_00337720 predicted 551
9 SASI_Hs02_00337721 predicted 1672
10 SASI_Hs01_00200776 predicted 530
11 SASI_Hs01_00200767 predicted 1458
12 SASI_Hs01_00200772 predicted 1188
13 SASI_Hs01_00200775 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092814 predicted 2548
2 SASI_Rn01_00092815 predicted 2564
3 SASI_Rn01_00092816 predicted 1736
4 SASI_Rn01_00092817 predicted 2395
5 SASI_Rn01_00092818 predicted 3009
6 SASI_Rn01_00092819 predicted 1108
7 SASI_Rn01_00092820 predicted 1322
8 SASI_Rn01_00092821 predicted 2392
9 SASI_Rn01_00092822 predicted 518
10 SASI_Rn01_00092823 predicted 1726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294176 predicted 1139
2 SASI_Mm02_00294177 predicted 491
3 SASI_Mm02_00294178 predicted 1865
4 SASI_Mm02_00294179 predicted 2533
5 SASI_Mm02_00294180 predicted 1737
6 SASI_Mm02_00294181 predicted 1964
7 SASI_Mm02_00294182 predicted 2438
8 SASI_Mm02_00294183 predicted 1141
9 SASI_Mm02_00294184 predicted 588
10 SASI_Mm02_00294185 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338903 predicted 1212
2 SASI_Mm02_00338904 predicted 579
3 SASI_Mm02_00338905 predicted 1944
4 SASI_Mm02_00338906 predicted 2612
5 SASI_Mm02_00338907 predicted 1817
6 SASI_Mm02_00338908 predicted 2047
7 SASI_Mm02_00338909 predicted 2518
8 SASI_Mm02_00338910 predicted 1213
9 SASI_Mm02_00338911 predicted 677
10 SASI_Mm02_00338912 predicted 2532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260542 predicted 1107
2 SASI_Mm01_00260543 predicted 1839
3 SASI_Mm01_00260544 predicted 2501
4 SASI_Mm01_00260545 predicted 1705
5 SASI_Mm01_00260546 predicted 1938
6 SASI_Mm01_00260547 predicted 2410
7 SASI_Mm01_00260548 predicted 1114
8 SASI_Mm01_00260549 predicted 566
9 SASI_Mm01_00260550 predicted 2511
10 SASI_Mm01_00260551 predicted 2419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215848 predicted 1291
2 SASI_Mm01_00215849 predicted 2025
3 SASI_Mm01_00215850 predicted 2688
4 SASI_Mm01_00215851 predicted 1894
5 SASI_Mm01_00215852 predicted 2124
6 SASI_Mm01_00215853 predicted 2591
7 SASI_Mm01_00215854 predicted 1298
8 SASI_Mm01_00215855 predicted 753
9 SASI_Mm01_00215856 predicted 2693
10 SASI_Mm01_00215857 predicted 2609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209806 predicted 205
2 SASI_Mm01_00209807 predicted 68
3 SASI_Mm01_00209808 predicted 285
4 SASI_Mm01_00209809 predicted 215
5 SASI_Mm01_00209810 predicted 341
6 SASI_Mm01_00209811 predicted 249
7 SASI_Mm01_00209812 predicted 236
8 SASI_Mm01_00209813 predicted 197
9 SASI_Mm01_00209814 predicted 217
10 SASI_Mm01_00209815 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214858 predicted 2439
2 SASI_Mm01_00214859 predicted 2737
3 SASI_Mm01_00214860 predicted 946
4 SASI_Mm01_00214861 predicted 842
5 SASI_Mm01_00214862 predicted 1569
6 SASI_Mm01_00214863 predicted 2230
7 SASI_Mm01_00214864 predicted 2290
8 SASI_Mm01_00214865 predicted 1669
9 SASI_Mm01_00214866 predicted 2145
10 SASI_Mm01_00214867 predicted 2245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260769 predicted 787
2 SASI_Mm01_00260770 predicted 2622
3 SASI_Mm01_00260771 predicted 2934
4 SASI_Mm01_00260772 predicted 1032
5 SASI_Mm01_00260773 predicted 1752
6 SASI_Mm01_00260774 predicted 2474
7 SASI_Mm01_00260775 predicted 1867
8 SASI_Mm01_00260776 predicted 2334
9 SASI_Mm01_00260777 predicted 2433
10 SASI_Mm01_00260778 predicted 2462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004486
VALIDATED
GOLGA2 MISSION shRNA Bacterial Glycerol Stock
golgin A2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004486.3-1672s1c1
Sequence:CCGGGCGGATTTGTAAAGCTGACTACTCGAGTAGTCAGCTTTACAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004486.3-2987s1c1
Sequence:CCGGCGAGAATGATGAGGTGAAGATCTCGAGATCTTCACCTCATCATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004486.3-906s1c1
Sequence:CCGGGAGTTATACAAGAACACCCAACTCGAGTTGGGTGTTCTTGTATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004486.3-1187s1c1
Sequence:CCGGGAGAGATAAATATGCGGAGAACTCGAGTTCTCCGCATATTTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-1674s21c1
Sequence:CCGGGCGGATTTGTAAAGCTGACTACTCGAGTAGTCAGCTTTACAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-252s21c1
Sequence:CCGGCATCTGATGACACCGTGTTACCTCGAGGTAACACGGTGTCATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-2989s21c1
Sequence:CCGGCGAGAATGATGAGGTGAAGATCTCGAGATCTTCACCTCATCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-2431s21c1
Sequence:CCGGGAAGCTGCAGAGCCGCTTTATCTCGAGATAAAGCGGCTCTGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004486.4-3262s21c1
Sequence:CCGGATGGGTAACTTATGGTATAAACTCGAGTTTATACCATAAGTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004486
VALIDATED
GOLGA2 MISSION shRNA shRNA Plasmid DNA
golgin A2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004486.3-1672s1c1
Sequence:CCGGGCGGATTTGTAAAGCTGACTACTCGAGTAGTCAGCTTTACAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004486.3-2987s1c1
Sequence:CCGGCGAGAATGATGAGGTGAAGATCTCGAGATCTTCACCTCATCATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004486.3-906s1c1
Sequence:CCGGGAGTTATACAAGAACACCCAACTCGAGTTGGGTGTTCTTGTATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004486.3-1187s1c1
Sequence:CCGGGAGAGATAAATATGCGGAGAACTCGAGTTCTCCGCATATTTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-1674s21c1
Sequence:CCGGGCGGATTTGTAAAGCTGACTACTCGAGTAGTCAGCTTTACAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-252s21c1
Sequence:CCGGCATCTGATGACACCGTGTTACCTCGAGGTAACACGGTGTCATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-2989s21c1
Sequence:CCGGCGAGAATGATGAGGTGAAGATCTCGAGATCTTCACCTCATCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-2431s21c1
Sequence:CCGGGAAGCTGCAGAGCCGCTTTATCTCGAGATAAAGCGGCTCTGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004486.4-3262s21c1
Sequence:CCGGATGGGTAACTTATGGTATAAACTCGAGTTTATACCATAAGTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004486
VALIDATED
GOLGA2 MISSION shRNA Lentiviral Transduction Particles
golgin A2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004486.3-1672s1c1
Sequence:CCGGGCGGATTTGTAAAGCTGACTACTCGAGTAGTCAGCTTTACAAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004486.3-2987s1c1
Sequence:CCGGCGAGAATGATGAGGTGAAGATCTCGAGATCTTCACCTCATCATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004486.3-906s1c1
Sequence:CCGGGAGTTATACAAGAACACCCAACTCGAGTTGGGTGTTCTTGTATAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004486.3-1187s1c1
Sequence:CCGGGAGAGATAAATATGCGGAGAACTCGAGTTCTCCGCATATTTATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-1674s21c1
Sequence:CCGGGCGGATTTGTAAAGCTGACTACTCGAGTAGTCAGCTTTACAAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-252s21c1
Sequence:CCGGCATCTGATGACACCGTGTTACCTCGAGGTAACACGGTGTCATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-2989s21c1
Sequence:CCGGCGAGAATGATGAGGTGAAGATCTCGAGATCTTCACCTCATCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004486.4-2431s21c1
Sequence:CCGGGAAGCTGCAGAGCCGCTTTATCTCGAGATAAAGCGGCTCTGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004486.4-3262s21c1
Sequence:CCGGATGGGTAACTTATGGTATAAACTCGAGTTTATACCATAAGTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080968
VALIDATED
GOLGA2 MISSION shRNA Bacterial Glycerol Stock
golgin A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080968.1-2263s21c1
Sequence:GTACCGGGCATTCTTTAATGCCGCTATACTCGAGTATAGCGGCATTAAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-4223s21c1
Sequence:CCGGTTGGGCTGGGAACCTTATTTACTCGAGTAAATAAGGTTCCCAGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-2857s21c1
Sequence:CCGGGTGAGCCTGGCTGACGATATACTCGAGTATATCGTCAGCCAGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-897s21c1
Sequence:CCGGGAAACAGGCAGACAGGTATAACTCGAGTTATACCTGTCTGCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-266s21c1
Sequence:CCGGATGTGCCCACAGACCATATTGCTCGAGCAATATGGTCTGTGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080968
VALIDATED
GOLGA2 MISSION shRNA shRNA Plasmid DNA
golgin A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080968.1-2263s21c1
Sequence:GTACCGGGCATTCTTTAATGCCGCTATACTCGAGTATAGCGGCATTAAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-4223s21c1
Sequence:CCGGTTGGGCTGGGAACCTTATTTACTCGAGTAAATAAGGTTCCCAGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-2857s21c1
Sequence:CCGGGTGAGCCTGGCTGACGATATACTCGAGTATATCGTCAGCCAGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-897s21c1
Sequence:CCGGGAAACAGGCAGACAGGTATAACTCGAGTTATACCTGTCTGCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-266s21c1
Sequence:CCGGATGTGCCCACAGACCATATTGCTCGAGCAATATGGTCTGTGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080968
VALIDATED
GOLGA2 MISSION shRNA Lentiviral Transduction Particles
golgin A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080968.1-2263s21c1
Sequence:GTACCGGGCATTCTTTAATGCCGCTATACTCGAGTATAGCGGCATTAAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-4223s21c1
Sequence:CCGGTTGGGCTGGGAACCTTATTTACTCGAGTAAATAAGGTTCCCAGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-2857s21c1
Sequence:CCGGGTGAGCCTGGCTGACGATATACTCGAGTATATCGTCAGCCAGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-897s21c1
Sequence:CCGGGAAACAGGCAGACAGGTATAACTCGAGTTATACCTGTCTGCCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080968.1-266s21c1
Sequence:CCGGATGTGCCCACAGACCATATTGCTCGAGCAATATGGTCTGTGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks