EMAIL THIS PAGE TO A FRIEND

GOLGA2P5

golgin A2 pseudogene 5

20 Gene Product Result for
Synonyms: GOLGA2B GOLGA2L1
Species: Human GOLGA2P5(55592)
UniProtKB ID: Q9HBQ8, Q9NSV2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017600 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027947 predicted 1757
2 SASI_Hs01_00027948 predicted 1742
3 SASI_Hs01_00027949 predicted 1751
4 SASI_Hs01_00027950 predicted 1508
5 SASI_Hs01_00027951 predicted 2008
6 SASI_Hs02_00350274 predicted 1564
7 SASI_Hs02_00350275 predicted 1298
8 SASI_Hs01_00027952 predicted 1512
9 SASI_Hs01_00027953 predicted 1505
10 SASI_Hs01_00027954 predicted 1810
11 SASI_Hs01_00027955 predicted 2157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017600
GOLGA2P5 MISSION shRNA Bacterial Glycerol Stock
golgin A2 pseudogene 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1604s21c1
Sequence:CCGGCAAGGGAGAGGTGAAGGTGAACTCGAGTTCACCTTCACCTCTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1304s21c1
Sequence:CCGGCAGAAGGCCATGGTGGCATTTCTCGAGAAATGCCACCATGGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1645s21c1
Sequence:CCGGTTGTGGACGACTGCAACAAGTCTCGAGACTTGTTGCAGTCGTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1517s21c1
Sequence:CCGGAGAAGCTGTGGGAGAGTACATCTCGAGATGTACTCTCCCACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017600.1-2017s21c1
Sequence:CCGGACCAGACTGATGAGAACAATGCTCGAGCATTGTTCTCATCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-1901s1c1
Sequence:CCGGGAAGCATTCTCCCTGTGACAACTCGAGTTGTCACAGGGAGAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-1840s1c1
Sequence:CCGGCCAAAGATCTTTGTGAGGTGACTCGAGTCACCTCACAAAGATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-2015s1c1
Sequence:CCGGGTACCAGACTGATGAGAACAACTCGAGTTGTTCTCATCAGTCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017600
GOLGA2P5 MISSION shRNA shRNA Plasmid DNA
golgin A2 pseudogene 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1604s21c1
Sequence:CCGGCAAGGGAGAGGTGAAGGTGAACTCGAGTTCACCTTCACCTCTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1304s21c1
Sequence:CCGGCAGAAGGCCATGGTGGCATTTCTCGAGAAATGCCACCATGGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1645s21c1
Sequence:CCGGTTGTGGACGACTGCAACAAGTCTCGAGACTTGTTGCAGTCGTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1517s21c1
Sequence:CCGGAGAAGCTGTGGGAGAGTACATCTCGAGATGTACTCTCCCACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017600.1-2017s21c1
Sequence:CCGGACCAGACTGATGAGAACAATGCTCGAGCATTGTTCTCATCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-1901s1c1
Sequence:CCGGGAAGCATTCTCCCTGTGACAACTCGAGTTGTCACAGGGAGAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-1840s1c1
Sequence:CCGGCCAAAGATCTTTGTGAGGTGACTCGAGTCACCTCACAAAGATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-2015s1c1
Sequence:CCGGGTACCAGACTGATGAGAACAACTCGAGTTGTTCTCATCAGTCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017600
GOLGA2P5 MISSION shRNA Lentiviral Transduction Particles
golgin A2 pseudogene 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1604s21c1
Sequence:CCGGCAAGGGAGAGGTGAAGGTGAACTCGAGTTCACCTTCACCTCTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1304s21c1
Sequence:CCGGCAGAAGGCCATGGTGGCATTTCTCGAGAAATGCCACCATGGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1645s21c1
Sequence:CCGGTTGTGGACGACTGCAACAAGTCTCGAGACTTGTTGCAGTCGTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017600.1-1517s21c1
Sequence:CCGGAGAAGCTGTGGGAGAGTACATCTCGAGATGTACTCTCCCACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017600.1-2017s21c1
Sequence:CCGGACCAGACTGATGAGAACAATGCTCGAGCATTGTTCTCATCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-1901s1c1
Sequence:CCGGGAAGCATTCTCCCTGTGACAACTCGAGTTGTCACAGGGAGAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-1840s1c1
Sequence:CCGGCCAAAGATCTTTGTGAGGTGACTCGAGTCACCTCACAAAGATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017600.1-2015s1c1
Sequence:CCGGGTACCAGACTGATGAGAACAACTCGAGTTGTTCTCATCAGTCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks