EMAIL THIS PAGE TO A FRIEND

GOLGA3

golgin A3

78 Gene Product Result for
Synonyms: GCP170 MEA-2
Gene ID:
Human(2802) Summary: The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
Mouse(269682) golgi autoantigen, golgin subfamily a, 3
Rat(312077) golgin A3
Zebrafish(570879) golgi autoantigen, golgin subfamily a, 3
chicken(416791) golgin A3
dog(477435) golgin A3
cow(533600) golgin A3
Horse(100061493) golgin A3
sheep(101112088) golgin A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005895 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005895 Rosetta Predictions human pricing
NM_001107847 Rosetta Predictions rat pricing
NM_008146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246154 predicted 2099
2 SASI_Hs01_00246155 predicted 1298
3 SASI_Hs01_00246156 predicted 5102
4 SASI_Hs02_00340496 predicted 2982
5 SASI_Hs01_00246158 predicted 3967
6 SASI_Hs01_00246159 predicted 2995
7 SASI_Hs01_00246160 predicted 2994
8 SASI_Hs01_00246161 predicted 1041
9 SASI_Hs01_00246162 predicted 933
10 SASI_Hs01_00246163 predicted 3821
11 SASI_Hs01_00246157 predicted 3089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232865 predicted 1596
2 SASI_Rn02_00232866 predicted 2745
3 SASI_Rn02_00232867 predicted 2578
4 SASI_Rn02_00232868 predicted 3910
5 SASI_Rn02_00232869 predicted 4008
6 SASI_Rn02_00232870 predicted 4410
7 SASI_Rn02_00232871 predicted 2319
8 SASI_Rn02_00232872 predicted 4360
9 SASI_Rn02_00232873 predicted 4425
10 SASI_Rn02_00232874 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313245 predicted 4299
2 SASI_Mm02_00313246 predicted 2050
3 SASI_Mm01_00064219 predicted 3877
4 SASI_Mm01_00064220 predicted 2564
5 SASI_Mm01_00064221 predicted 3449
6 SASI_Mm01_00064223 predicted 2950
7 SASI_Mm01_00064224 predicted 528
8 SASI_Mm01_00064225 predicted 4285
9 SASI_Mm02_00313247 predicted 1472
10 SASI_Mm01_00064226 predicted 1826
11 SASI_Mm01_00064222 predicted 1482
12 SASI_Mm01_00064227 predicted 1294
13 SASI_Mm01_00064228 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008146
VALIDATED
GOLGA3 MISSION shRNA Bacterial Glycerol Stock
golgin A3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-961s1c1
Sequence:CCGGGCTGGCACATTCTAAAGAGAACTCGAGTTCTCTTTAGAATGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-2780s1c1
Sequence:CCGGCAGAAAGTAAAGGAGCAGTTTCTCGAGAAACTGCTCCTTTACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-3885s1c1
Sequence:CCGGGCCACTTTAAGGCAGCTACTTCTCGAGAAGTAGCTGCCTTAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-3886s1c1
Sequence:CCGGCCACTTTAAGGCAGCTACTTTCTCGAGAAAGTAGCTGCCTTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-1340s1c1
Sequence:CCGGCCTTCAATTAAAGACGTACTACTCGAGTAGTACGTCTTTAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-4287s21c1
Sequence:CCGGAGACGCAGAAGGATAAGTTTACTCGAGTAAACTTATCCTTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-760s21c1
Sequence:CCGGGCTGATGCAGTACCGAGTTAACTCGAGTTAACTCGGTACTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-1006s21c1
Sequence:CCGGTCGGTCTCTGGCTGACTATAGCTCGAGCTATAGTCAGCCAGAGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-3886s21c1
Sequence:CCGGCCACTTTAAGGCAGCTACTTTCTCGAGAAAGTAGCTGCCTTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-797s21c1
Sequence:CCGGTCCAGTCAACCTGCAACTAAACTCGAGTTTAGTTGCAGGTTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008146
VALIDATED
GOLGA3 MISSION shRNA shRNA Plasmid DNA
golgin A3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-961s1c1
Sequence:CCGGGCTGGCACATTCTAAAGAGAACTCGAGTTCTCTTTAGAATGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-2780s1c1
Sequence:CCGGCAGAAAGTAAAGGAGCAGTTTCTCGAGAAACTGCTCCTTTACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-3885s1c1
Sequence:CCGGGCCACTTTAAGGCAGCTACTTCTCGAGAAGTAGCTGCCTTAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-3886s1c1
Sequence:CCGGCCACTTTAAGGCAGCTACTTTCTCGAGAAAGTAGCTGCCTTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-1340s1c1
Sequence:CCGGCCTTCAATTAAAGACGTACTACTCGAGTAGTACGTCTTTAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-4287s21c1
Sequence:CCGGAGACGCAGAAGGATAAGTTTACTCGAGTAAACTTATCCTTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-760s21c1
Sequence:CCGGGCTGATGCAGTACCGAGTTAACTCGAGTTAACTCGGTACTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-1006s21c1
Sequence:CCGGTCGGTCTCTGGCTGACTATAGCTCGAGCTATAGTCAGCCAGAGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-3886s21c1
Sequence:CCGGCCACTTTAAGGCAGCTACTTTCTCGAGAAAGTAGCTGCCTTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-797s21c1
Sequence:CCGGTCCAGTCAACCTGCAACTAAACTCGAGTTTAGTTGCAGGTTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008146
VALIDATED
GOLGA3 MISSION shRNA Lentiviral Transduction Particles
golgin A3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-961s1c1
Sequence:CCGGGCTGGCACATTCTAAAGAGAACTCGAGTTCTCTTTAGAATGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-2780s1c1
Sequence:CCGGCAGAAAGTAAAGGAGCAGTTTCTCGAGAAACTGCTCCTTTACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-3885s1c1
Sequence:CCGGGCCACTTTAAGGCAGCTACTTCTCGAGAAGTAGCTGCCTTAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-3886s1c1
Sequence:CCGGCCACTTTAAGGCAGCTACTTTCTCGAGAAAGTAGCTGCCTTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008146.3-1340s1c1
Sequence:CCGGCCTTCAATTAAAGACGTACTACTCGAGTAGTACGTCTTTAATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-4287s21c1
Sequence:CCGGAGACGCAGAAGGATAAGTTTACTCGAGTAAACTTATCCTTCTGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-760s21c1
Sequence:CCGGGCTGATGCAGTACCGAGTTAACTCGAGTTAACTCGGTACTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-1006s21c1
Sequence:CCGGTCGGTCTCTGGCTGACTATAGCTCGAGCTATAGTCAGCCAGAGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-3886s21c1
Sequence:CCGGCCACTTTAAGGCAGCTACTTTCTCGAGAAAGTAGCTGCCTTAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008146.3-797s21c1
Sequence:CCGGTCCAGTCAACCTGCAACTAAACTCGAGTTTAGTTGCAGGTTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005895
GOLGA3 MISSION shRNA Bacterial Glycerol Stock
golgin A3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3840s1c1
Sequence:CCGGGAGGCTTTAGGAAGAAGATAACTCGAGTTATCTTCTTCCTAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-2977s1c1
Sequence:CCGGGTCGGAAACTTTAGAGAAGTTCTCGAGAACTTCTCTAAAGTTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3893s1c1
Sequence:CCGGCTTGAATTAGAGCACGAGAAACTCGAGTTTCTCGTGCTCTAATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-6793s1c1
Sequence:CCGGCCTCAAGTTGTGGCTGTTCTTCTCGAGAAGAACAGCCACAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3367s1c1
Sequence:CCGGGCAGTCGTTGCAGTTCGATAACTCGAGTTATCGAACTGCAACGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-2498s1c1
Sequence:CCGGGCTGACATGTTGGATCAGGAACTCGAGTTCCTGATCCAACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-4534s1c1
Sequence:CCGGGCAGAACGTCAAGTCTGAGTTCTCGAGAACTCAGACTTGACGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-5441s1c1
Sequence:CCGGGCAGTTTCTCACTTCCCTGTTCTCGAGAACAGGGAAGTGAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005895.2-5974s1c1
Sequence:CCGGCCAGAGTTACTTCAGTGCATACTCGAGTATGCACTGAAGTAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-3865s1c1
Sequence:CCGGCCTTGAGGAGTCAAACAAGAACTCGAGTTCTTGTTTGACTCCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-2654s1c1
Sequence:CCGGGAGCAGGTGAAGTTGACTTTACTCGAGTAAAGTCAACTTCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-1299s1c1
Sequence:CCGGCCGATTACAGAACTGAAGATTCTCGAGAATCTTCAGTTCTGTAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-6261s1c1
Sequence:CCGGCGTGGTATATGTGAGATTGATCTCGAGATCAATCTCACATATACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005895
GOLGA3 MISSION shRNA shRNA Plasmid DNA
golgin A3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3840s1c1
Sequence:CCGGGAGGCTTTAGGAAGAAGATAACTCGAGTTATCTTCTTCCTAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-2977s1c1
Sequence:CCGGGTCGGAAACTTTAGAGAAGTTCTCGAGAACTTCTCTAAAGTTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3893s1c1
Sequence:CCGGCTTGAATTAGAGCACGAGAAACTCGAGTTTCTCGTGCTCTAATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-6793s1c1
Sequence:CCGGCCTCAAGTTGTGGCTGTTCTTCTCGAGAAGAACAGCCACAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3367s1c1
Sequence:CCGGGCAGTCGTTGCAGTTCGATAACTCGAGTTATCGAACTGCAACGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-2498s1c1
Sequence:CCGGGCTGACATGTTGGATCAGGAACTCGAGTTCCTGATCCAACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-4534s1c1
Sequence:CCGGGCAGAACGTCAAGTCTGAGTTCTCGAGAACTCAGACTTGACGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-5441s1c1
Sequence:CCGGGCAGTTTCTCACTTCCCTGTTCTCGAGAACAGGGAAGTGAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005895.2-5974s1c1
Sequence:CCGGCCAGAGTTACTTCAGTGCATACTCGAGTATGCACTGAAGTAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-3865s1c1
Sequence:CCGGCCTTGAGGAGTCAAACAAGAACTCGAGTTCTTGTTTGACTCCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-2654s1c1
Sequence:CCGGGAGCAGGTGAAGTTGACTTTACTCGAGTAAAGTCAACTTCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-1299s1c1
Sequence:CCGGCCGATTACAGAACTGAAGATTCTCGAGAATCTTCAGTTCTGTAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-6261s1c1
Sequence:CCGGCGTGGTATATGTGAGATTGATCTCGAGATCAATCTCACATATACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005895
GOLGA3 MISSION shRNA Lentiviral Transduction Particles
golgin A3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3840s1c1
Sequence:CCGGGAGGCTTTAGGAAGAAGATAACTCGAGTTATCTTCTTCCTAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-2977s1c1
Sequence:CCGGGTCGGAAACTTTAGAGAAGTTCTCGAGAACTTCTCTAAAGTTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3893s1c1
Sequence:CCGGCTTGAATTAGAGCACGAGAAACTCGAGTTTCTCGTGCTCTAATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-6793s1c1
Sequence:CCGGCCTCAAGTTGTGGCTGTTCTTCTCGAGAAGAACAGCCACAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-3367s1c1
Sequence:CCGGGCAGTCGTTGCAGTTCGATAACTCGAGTTATCGAACTGCAACGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-2498s1c1
Sequence:CCGGGCTGACATGTTGGATCAGGAACTCGAGTTCCTGATCCAACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-4534s1c1
Sequence:CCGGGCAGAACGTCAAGTCTGAGTTCTCGAGAACTCAGACTTGACGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-5441s1c1
Sequence:CCGGGCAGTTTCTCACTTCCCTGTTCTCGAGAACAGGGAAGTGAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005895.2-5974s1c1
Sequence:CCGGCCAGAGTTACTTCAGTGCATACTCGAGTATGCACTGAAGTAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005895.2-3865s1c1
Sequence:CCGGCCTTGAGGAGTCAAACAAGAACTCGAGTTCTTGTTTGACTCCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-2654s1c1
Sequence:CCGGGAGCAGGTGAAGTTGACTTTACTCGAGTAAAGTCAACTTCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005895.2-1299s1c1
Sequence:CCGGCCGATTACAGAACTGAAGATTCTCGAGAATCTTCAGTTCTGTAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005895.2-6261s1c1
Sequence:CCGGCGTGGTATATGTGAGATTGATCTCGAGATCAATCTCACATATACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks