EMAIL THIS PAGE TO A FRIEND

GOLGA4

golgin A4

135 Gene Product Result for
Synonyms: GCP2 GOLG MU-RMS-40.18 p230
UniProtKB ID: Q13439, F8W8Q7, Q13270, Q13654, Q14436, Q59EW8
Gene ID:
Human(2803) Summary: The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Mouse(54214) golgi autoantigen, golgin subfamily a, 4
Rat(501069) golgin A4
sheep(101109394) golgin A4
Zebrafish(559226) golgin A4
dog(477020) golgin A4
chicken(420758) golgin A4
cow(538893) golgin A4
Horse(100050216) golgin A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035102 Anti-GOLGA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002078 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134961 MISSION® esiRNA esiRNA human GOLGA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002078 Rosetta Predictions human pricing
XM_001061798 Rosetta Predictions rat pricing
XM_001077249 Rosetta Predictions rat pricing
XM_236718 Rosetta Predictions rat pricing
NM_018748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150463 predicted 6763
2 SASI_Hs01_00150465 predicted 1372
3 SASI_Hs02_00333152 predicted 6990
4 SASI_Hs01_00150467 predicted 5829
5 SASI_Hs01_00150468 predicted 1715
6 SASI_Hs01_00150469 predicted 454
7 SASI_Hs02_00333153 predicted 547
8 SASI_Hs01_00150470 predicted 598
9 SASI_Hs01_00150471 predicted 5251
10 SASI_Hs02_00333154 predicted 4080
11 SASI_Hs01_00150462 predicted 1999
12 SASI_Hs01_00150464 predicted 6824
13 SASI_Hs01_00150466 predicted 3609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301377 predicted 5803
2 SASI_Rn02_00301378 predicted 1501
3 SASI_Rn02_00301379 predicted 5265
4 SASI_Rn02_00301380 predicted 1560
5 SASI_Rn02_00301381 predicted 4933
6 SASI_Rn02_00301382 predicted 1754
7 SASI_Rn02_00301383 predicted 955
8 SASI_Rn02_00301384 predicted 1576
9 SASI_Rn02_00301385 predicted 1302
10 SASI_Rn02_00301386 predicted 5877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356373 predicted 5567
2 SASI_Rn02_00356374 predicted 1272
3 SASI_Rn02_00356375 predicted 5030
4 SASI_Rn02_00356376 predicted 1335
5 SASI_Rn02_00356377 predicted 4704
6 SASI_Rn02_00356378 predicted 1523
7 SASI_Rn02_00356379 predicted 725
8 SASI_Rn02_00356380 predicted 1344
9 SASI_Rn02_00356381 predicted 1076
10 SASI_Rn02_00356382 predicted 5647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00159093 predicted 9855
2 SASI_Rn01_00159094 predicted 7932
3 SASI_Rn01_00159095 predicted 7598
4 SASI_Rn01_00159096 predicted 3444
5 SASI_Rn01_00159097 predicted 9225
6 SASI_Rn01_00159098 predicted 9565
7 SASI_Rn01_00159099 predicted 4242
8 SASI_Rn01_00159100 predicted 13011
9 SASI_Rn01_00159101 predicted 3969
10 SASI_Rn01_00159102 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122825 predicted 4744
2 SASI_Mm01_00122826 predicted 3478
3 SASI_Mm01_00122827 predicted 6581
4 SASI_Mm01_00122828 predicted 6341
5 SASI_Mm02_00324018 predicted 773
6 SASI_Mm01_00122829 predicted 5273
7 SASI_Mm01_00122830 predicted 1092
8 SASI_Mm01_00122831 predicted 928
9 SASI_Mm01_00122832 predicted 4334
10 SASI_Mm01_00122833 predicted 3885
11 SASI_Mm01_00122834 predicted 6941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018748
VALIDATED
GOLGA4 MISSION shRNA Bacterial Glycerol Stock
golgin A4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-1818s21c1
Sequence:CCGGGCAGCAAGAATCCTTGGCTTTCTCGAGAAAGCCAAGGATTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-4574s21c1
Sequence:CCGGCCCAGCACCAAAGCACTATTACTCGAGTAATAGTGCTTTGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-4756s21c1
Sequence:CCGGGACTTAGAGACTGCGTTAAAGCTCGAGCTTTAACGCAGTCTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-7340s21c1
Sequence:CCGGCCTAGTTCTTTATGCTATGATCTCGAGATCATAGCATAAAGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-6597s21c1
Sequence:CCGGCCATAATTTAGAAGACCGTTTCTCGAGAAACGGTCTTCTAAATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-1817s1c1
Sequence:CCGGGCAGCAAGAATCCTTGGCTTTCTCGAGAAAGCCAAGGATTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-6596s1c1
Sequence:CCGGCCATAATTTAGAAGACCGTTTCTCGAGAAACGGTCTTCTAAATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-1863s1c1
Sequence:CCGGGCCATCCTTACAGAGAGTGAACTCGAGTTCACTCTCTGTAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-7335s1c1
Sequence:CCGGCCTAGTTCTTTATGCTATGATCTCGAGATCATAGCATAAAGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-4573s1c1
Sequence:CCGGCCCAGCACCAAAGCACTATTACTCGAGTAATAGTGCTTTGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018748
VALIDATED
GOLGA4 MISSION shRNA shRNA Plasmid DNA
golgin A4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-1818s21c1
Sequence:CCGGGCAGCAAGAATCCTTGGCTTTCTCGAGAAAGCCAAGGATTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-4574s21c1
Sequence:CCGGCCCAGCACCAAAGCACTATTACTCGAGTAATAGTGCTTTGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-4756s21c1
Sequence:CCGGGACTTAGAGACTGCGTTAAAGCTCGAGCTTTAACGCAGTCTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-7340s21c1
Sequence:CCGGCCTAGTTCTTTATGCTATGATCTCGAGATCATAGCATAAAGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-6597s21c1
Sequence:CCGGCCATAATTTAGAAGACCGTTTCTCGAGAAACGGTCTTCTAAATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-1817s1c1
Sequence:CCGGGCAGCAAGAATCCTTGGCTTTCTCGAGAAAGCCAAGGATTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-6596s1c1
Sequence:CCGGCCATAATTTAGAAGACCGTTTCTCGAGAAACGGTCTTCTAAATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-1863s1c1
Sequence:CCGGGCCATCCTTACAGAGAGTGAACTCGAGTTCACTCTCTGTAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-7335s1c1
Sequence:CCGGCCTAGTTCTTTATGCTATGATCTCGAGATCATAGCATAAAGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-4573s1c1
Sequence:CCGGCCCAGCACCAAAGCACTATTACTCGAGTAATAGTGCTTTGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018748
VALIDATED
GOLGA4 MISSION shRNA Lentiviral Transduction Particles
golgin A4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-1818s21c1
Sequence:CCGGGCAGCAAGAATCCTTGGCTTTCTCGAGAAAGCCAAGGATTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-4574s21c1
Sequence:CCGGCCCAGCACCAAAGCACTATTACTCGAGTAATAGTGCTTTGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-4756s21c1
Sequence:CCGGGACTTAGAGACTGCGTTAAAGCTCGAGCTTTAACGCAGTCTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-7340s21c1
Sequence:CCGGCCTAGTTCTTTATGCTATGATCTCGAGATCATAGCATAAAGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018748.3-6597s21c1
Sequence:CCGGCCATAATTTAGAAGACCGTTTCTCGAGAAACGGTCTTCTAAATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-1817s1c1
Sequence:CCGGGCAGCAAGAATCCTTGGCTTTCTCGAGAAAGCCAAGGATTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-6596s1c1
Sequence:CCGGCCATAATTTAGAAGACCGTTTCTCGAGAAACGGTCTTCTAAATTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-1863s1c1
Sequence:CCGGGCCATCCTTACAGAGAGTGAACTCGAGTTCACTCTCTGTAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-7335s1c1
Sequence:CCGGCCTAGTTCTTTATGCTATGATCTCGAGATCATAGCATAAAGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018748.2-4573s1c1
Sequence:CCGGCCCAGCACCAAAGCACTATTACTCGAGTAATAGTGCTTTGGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002078
VALIDATED
GOLGA4 MISSION shRNA Bacterial Glycerol Stock
golgin A4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002078.3-5630s21c1
Sequence:CCGGCGCTTAATAAAGCTAGAACATCTCGAGATGTTCTAGCTTTATTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1221s21c1
Sequence:CCGGAGGAACAATGTACACTATTAACTCGAGTTAATAGTGTACATTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-7346s21c1
Sequence:CCGGCGGCTTACCTTTCCTATTTATCTCGAGATAAATAGGAAAGGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1349s21c1
Sequence:CCGGCGTGATGCAAAGAACTTAATTCTCGAGAATTAAGTTCTTTGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002078.3-2300s21c1
Sequence:CCGGGCCCACATAGAAGAAATGAATCTCGAGATTCATTTCTTCTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1171s21c1
Sequence:CCGGGCGTCAAGAGAACCTACTTAACTCGAGTTAAGTAGGTTCTCTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-3952s1c1
Sequence:CCGGGCTAGATATTTGCTGTAAGAACTCGAGTTCTTACAGCAAATATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-1349s1c1
Sequence:CCGGCGTGATGCAAAGAACTTAATTCTCGAGAATTAAGTTCTTTGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002078.3-6823s1c1
Sequence:CCGGCGAATTTGAGTATTTGCGAAACTCGAGTTTCGCAAATACTCAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-5630s1c1
Sequence:CCGGCGCTTAATAAAGCTAGAACATCTCGAGATGTTCTAGCTTTATTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002078.3-2300s1c1
Sequence:CCGGGCCCACATAGAAGAAATGAATCTCGAGATTCATTTCTTCTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002078
VALIDATED
GOLGA4 MISSION shRNA shRNA Plasmid DNA
golgin A4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002078.3-5630s21c1
Sequence:CCGGCGCTTAATAAAGCTAGAACATCTCGAGATGTTCTAGCTTTATTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1221s21c1
Sequence:CCGGAGGAACAATGTACACTATTAACTCGAGTTAATAGTGTACATTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-7346s21c1
Sequence:CCGGCGGCTTACCTTTCCTATTTATCTCGAGATAAATAGGAAAGGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1349s21c1
Sequence:CCGGCGTGATGCAAAGAACTTAATTCTCGAGAATTAAGTTCTTTGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002078.3-2300s21c1
Sequence:CCGGGCCCACATAGAAGAAATGAATCTCGAGATTCATTTCTTCTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1171s21c1
Sequence:CCGGGCGTCAAGAGAACCTACTTAACTCGAGTTAAGTAGGTTCTCTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-3952s1c1
Sequence:CCGGGCTAGATATTTGCTGTAAGAACTCGAGTTCTTACAGCAAATATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-1349s1c1
Sequence:CCGGCGTGATGCAAAGAACTTAATTCTCGAGAATTAAGTTCTTTGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002078.3-6823s1c1
Sequence:CCGGCGAATTTGAGTATTTGCGAAACTCGAGTTTCGCAAATACTCAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-5630s1c1
Sequence:CCGGCGCTTAATAAAGCTAGAACATCTCGAGATGTTCTAGCTTTATTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002078.3-2300s1c1
Sequence:CCGGGCCCACATAGAAGAAATGAATCTCGAGATTCATTTCTTCTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002078
VALIDATED
GOLGA4 MISSION shRNA Lentiviral Transduction Particles
golgin A4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002078.3-5630s21c1
Sequence:CCGGCGCTTAATAAAGCTAGAACATCTCGAGATGTTCTAGCTTTATTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1221s21c1
Sequence:CCGGAGGAACAATGTACACTATTAACTCGAGTTAATAGTGTACATTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-7346s21c1
Sequence:CCGGCGGCTTACCTTTCCTATTTATCTCGAGATAAATAGGAAAGGTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1349s21c1
Sequence:CCGGCGTGATGCAAAGAACTTAATTCTCGAGAATTAAGTTCTTTGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002078.3-2300s21c1
Sequence:CCGGGCCCACATAGAAGAAATGAATCTCGAGATTCATTTCTTCTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002078.3-1171s21c1
Sequence:CCGGGCGTCAAGAGAACCTACTTAACTCGAGTTAAGTAGGTTCTCTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-3952s1c1
Sequence:CCGGGCTAGATATTTGCTGTAAGAACTCGAGTTCTTACAGCAAATATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-1349s1c1
Sequence:CCGGCGTGATGCAAAGAACTTAATTCTCGAGAATTAAGTTCTTTGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002078.3-6823s1c1
Sequence:CCGGCGAATTTGAGTATTTGCGAAACTCGAGTTTCGCAAATACTCAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002078.3-5630s1c1
Sequence:CCGGCGCTTAATAAAGCTAGAACATCTCGAGATGTTCTAGCTTTATTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002078.3-2300s1c1
Sequence:CCGGGCCCACATAGAAGAAATGAATCTCGAGATTCATTTCTTCTATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks