EMAIL THIS PAGE TO A FRIEND

GOLGA5

golgin A5

50 Gene Product Result for
Synonyms: GOLIM5 RFG5 ret-II
UniProtKB ID: Q8TBA6, C9JRU1, O95287, Q03962, Q2TS49, Q9UQQ7
Gene ID:
Human(9950) Summary: The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein is a coiled-coil membrane protein that has been postulated to play a role in vesicle tethering and docking. Translocations involving this gene and the ret proto-oncogene have been found in tumor tissues; the chimeric sequences have been designated RET-II and PTC5. [provided by RefSeq, Feb 2010]
Mouse(27277) golgi autoantigen, golgin subfamily a, 5
Rat(299258) golgin A5
Zebrafish(406720) golgi autoantigen, golgin subfamily a, 5
cow(510412) golgin A5
Horse(100053313) golgin A5
dog(480233) golgin A5
chicken(423419) golgin A5
sheep(101114646) golgin A5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005113 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005113 Rosetta Predictions human pricing
NM_001033065 Rosetta Predictions rat pricing
NM_013747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233351 predicted 991
2 SASI_Hs01_00233352 predicted 1142
3 SASI_Hs01_00233353 predicted 635
4 SASI_Hs01_00233354 predicted 1169
5 SASI_Hs01_00233355 predicted 267
6 SASI_Hs01_00233356 predicted 817
7 SASI_Hs01_00233357 predicted 1484
8 SASI_Hs01_00233358 predicted 2071
9 SASI_Hs01_00233359 predicted 1351
10 SASI_Hs02_00339005 predicted 829
11 SASI_Hs01_00233360 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112812 predicted 1288
2 SASI_Rn01_00112813 predicted 1103
3 SASI_Rn01_00112814 predicted 800
4 SASI_Rn01_00112815 predicted 1901
5 SASI_Rn02_00203624 predicted 798
6 SASI_Rn01_00112816 predicted 1938
7 SASI_Rn01_00112817 predicted 579
8 SASI_Rn01_00112818 predicted 1594
9 SASI_Rn01_00112819 predicted 974
10 SASI_Rn01_00112820 predicted 1255
11 SASI_Rn01_00112811 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167036 predicted 1361
2 SASI_Mm01_00167037 predicted 797
3 SASI_Mm01_00167038 predicted 1208
4 SASI_Mm01_00167039 predicted 647
5 SASI_Mm01_00167040 predicted 2049
6 SASI_Mm01_00167041 predicted 1850
7 SASI_Mm01_00167042 predicted 1076
8 SASI_Mm01_00167043 predicted 1431
9 SASI_Mm01_00167044 predicted 2004
10 SASI_Mm01_00167045 predicted 2338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013747
VALIDATED
GOLGA5 MISSION shRNA Bacterial Glycerol Stock
golgin A5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013747.2-3199s1c1
Sequence:CCGGGCAGACAGTAATTTGACAAATCTCGAGATTTGTCAAATTACTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013747.4-269s21c1
Sequence:CCGGCCGGACAGAAAGCTAACTATACTCGAGTATAGTTAGCTTTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013747.4-2127s21c1
Sequence:CCGGTAGCTCCATTGACCAATTTAGCTCGAGCTAAATTGGTCAATGGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-1402s21c1
Sequence:CCGGACACGGATACTCCAATCTAAACTCGAGTTTAGATTGGAGTATCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-1759s21c1
Sequence:CCGGACACTGCAAAGCAGGATTAAACTCGAGTTTAATCCTGCTTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013747.4-1995s1c1
Sequence:CCGGCAACAGTGGATCTGCCATTAACTCGAGTTAATGGCAGATCCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-2509s21c1
Sequence:CCGGGAGTTCAGTTCCCTAGATATGCTCGAGCATATCTAGGGAACTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013747
VALIDATED
GOLGA5 MISSION shRNA shRNA Plasmid DNA
golgin A5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013747.2-3199s1c1
Sequence:CCGGGCAGACAGTAATTTGACAAATCTCGAGATTTGTCAAATTACTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013747.4-269s21c1
Sequence:CCGGCCGGACAGAAAGCTAACTATACTCGAGTATAGTTAGCTTTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013747.4-2127s21c1
Sequence:CCGGTAGCTCCATTGACCAATTTAGCTCGAGCTAAATTGGTCAATGGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-1402s21c1
Sequence:CCGGACACGGATACTCCAATCTAAACTCGAGTTTAGATTGGAGTATCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-1759s21c1
Sequence:CCGGACACTGCAAAGCAGGATTAAACTCGAGTTTAATCCTGCTTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013747.4-1995s1c1
Sequence:CCGGCAACAGTGGATCTGCCATTAACTCGAGTTAATGGCAGATCCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-2509s21c1
Sequence:CCGGGAGTTCAGTTCCCTAGATATGCTCGAGCATATCTAGGGAACTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013747
VALIDATED
GOLGA5 MISSION shRNA Lentiviral Transduction Particles
golgin A5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013747.2-3199s1c1
Sequence:CCGGGCAGACAGTAATTTGACAAATCTCGAGATTTGTCAAATTACTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013747.4-269s21c1
Sequence:CCGGCCGGACAGAAAGCTAACTATACTCGAGTATAGTTAGCTTTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013747.4-2127s21c1
Sequence:CCGGTAGCTCCATTGACCAATTTAGCTCGAGCTAAATTGGTCAATGGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-1402s21c1
Sequence:CCGGACACGGATACTCCAATCTAAACTCGAGTTTAGATTGGAGTATCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-1759s21c1
Sequence:CCGGACACTGCAAAGCAGGATTAAACTCGAGTTTAATCCTGCTTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013747.4-1995s1c1
Sequence:CCGGCAACAGTGGATCTGCCATTAACTCGAGTTAATGGCAGATCCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013747.4-2509s21c1
Sequence:CCGGGAGTTCAGTTCCCTAGATATGCTCGAGCATATCTAGGGAACTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005113
VALIDATED
GOLGA5 MISSION shRNA Bacterial Glycerol Stock
golgin A5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-998s1c1
Sequence:CCGGCCATTCAAAGAGTGATCGAATCTCGAGATTCGATCACTCTTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005113.2-1312s1c1
Sequence:CCGGCACGCCTTAATAAAGTGGAAACTCGAGTTTCCACTTTATTAAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005113.2-1642s1c1
Sequence:CCGGGCCAGATACATCAGCTCAGATCTCGAGATCTGAGCTGATGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-2595s1c1
Sequence:CCGGGCTCTGCTTTATCTGAGTTTACTCGAGTAAACTCAGATAAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-2066s1c1
Sequence:CCGGCGCCTCTGGAAGTAGTAGTAACTCGAGTTACTACTACTTCCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-2609s21c1
Sequence:CCGGGAGTTTAGTGGTCCTAATATACTCGAGTATATTAGGACCACTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-2082s21c1
Sequence:CCGGAGTAATGGGTCTTCGATTAATCTCGAGATTAATCGAAGACCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-1302s21c1
Sequence:CCGGGAGTTTGCTGCACGCCTTAATCTCGAGATTAAGGCGTGCAGCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005113.2-352s21c1
Sequence:CCGGGACCTAAATCTACGTATATTTCTCGAGAAATATACGTAGATTTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005113.2-2212s21c1
Sequence:CCGGCTAGTTCAATTGATCAGTTTACTCGAGTAAACTGATCAATTGAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005113
VALIDATED
GOLGA5 MISSION shRNA shRNA Plasmid DNA
golgin A5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-998s1c1
Sequence:CCGGCCATTCAAAGAGTGATCGAATCTCGAGATTCGATCACTCTTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005113.2-1312s1c1
Sequence:CCGGCACGCCTTAATAAAGTGGAAACTCGAGTTTCCACTTTATTAAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005113.2-1642s1c1
Sequence:CCGGGCCAGATACATCAGCTCAGATCTCGAGATCTGAGCTGATGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-2595s1c1
Sequence:CCGGGCTCTGCTTTATCTGAGTTTACTCGAGTAAACTCAGATAAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-2066s1c1
Sequence:CCGGCGCCTCTGGAAGTAGTAGTAACTCGAGTTACTACTACTTCCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-2609s21c1
Sequence:CCGGGAGTTTAGTGGTCCTAATATACTCGAGTATATTAGGACCACTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-2082s21c1
Sequence:CCGGAGTAATGGGTCTTCGATTAATCTCGAGATTAATCGAAGACCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-1302s21c1
Sequence:CCGGGAGTTTGCTGCACGCCTTAATCTCGAGATTAAGGCGTGCAGCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005113.2-352s21c1
Sequence:CCGGGACCTAAATCTACGTATATTTCTCGAGAAATATACGTAGATTTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005113.2-2212s21c1
Sequence:CCGGCTAGTTCAATTGATCAGTTTACTCGAGTAAACTGATCAATTGAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005113
VALIDATED
GOLGA5 MISSION shRNA Lentiviral Transduction Particles
golgin A5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-998s1c1
Sequence:CCGGCCATTCAAAGAGTGATCGAATCTCGAGATTCGATCACTCTTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005113.2-1312s1c1
Sequence:CCGGCACGCCTTAATAAAGTGGAAACTCGAGTTTCCACTTTATTAAGGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005113.2-1642s1c1
Sequence:CCGGGCCAGATACATCAGCTCAGATCTCGAGATCTGAGCTGATGTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118877    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-2595s1c1
Sequence:CCGGGCTCTGCTTTATCTGAGTTTACTCGAGTAAACTCAGATAAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005113.2-2066s1c1
Sequence:CCGGCGCCTCTGGAAGTAGTAGTAACTCGAGTTACTACTACTTCCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-2609s21c1
Sequence:CCGGGAGTTTAGTGGTCCTAATATACTCGAGTATATTAGGACCACTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-2082s21c1
Sequence:CCGGAGTAATGGGTCTTCGATTAATCTCGAGATTAATCGAAGACCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005113.2-1302s21c1
Sequence:CCGGGAGTTTGCTGCACGCCTTAATCTCGAGATTAAGGCGTGCAGCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005113.2-352s21c1
Sequence:CCGGGACCTAAATCTACGTATATTTCTCGAGAAATATACGTAGATTTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005113.2-2212s21c1
Sequence:CCGGCTAGTTCAATTGATCAGTTTACTCGAGTAAACTGATCAATTGAACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks