EMAIL THIS PAGE TO A FRIEND

GOLGA6B

golgin A6 family, member B

61 Gene Product Result for
Synonyms: GOLGA GOLGA6D
Species: Human GOLGA6B(55889)
UniProtKB ID: A6NDN3, A8MYY7
Gene ID:
Human(55889) Summary: This gene is found in a large, low copy repeat sequence or duplicon that is found in multiple copies, which are greater than 90% similar, on chromosome 15. Duplicons are associated with deletions, inversions and other chromosomal rearrangements that underlie genomic disease. This gene is a member of the golgin gene family, whose protein products localize to the Golgi apparatus. The majority of the related gene copies are thought to be transcribed pseudogenes. It is not known whether this gene is a pseudogene or if it encodes a golgin protein. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018652 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018652 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154988 predicted 82
2 SASI_Hs01_00154985 predicted 521
3 SASI_Hs01_00154987 predicted 522
4 SASI_Hs01_00154984 predicted 395
5 SASI_Hs01_00154986 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018652
GOLGA6B MISSION shRNA Bacterial Glycerol Stock
golgin A6 family, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018652.4-2294s21c1
Sequence:CCGGATGCTAGAGCCACTCACATTTCTCGAGAAATGTGAGTGGCTCTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018652.4-2271s21c1
Sequence:CCGGCACAATTCATTTACTCCATTTCTCGAGAAATGGAGTAAATGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-1388s1c1
Sequence:CCGGCGAGGATCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-936s1c1
Sequence:CCGGCAGCTACAAGATGAGGCCAAACTCGAGTTTGGCCTCATCTTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018652.2-330s1c1
Sequence:CCGGCAGCAGAAGAAACAAGTGGAACTCGAGTTCCACTTGTTTCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-528s1c1
Sequence:CCGGCAATACTCCTTACAGCGTATTCTCGAGAATACGCTGTAAGGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-816s1c1
Sequence:CCGGGAAGAGAAGAAGCGTGACATACTCGAGTATGTCACGCTTCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018652.2-723s1c1
Sequence:CCGGGAGCGAGACGAATATGCTAAACTCGAGTTTAGCATATTCGTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018652.2-2669s1c1
Sequence:CCGGCCCTCAATTGAGCACTGTTTACTCGAGTAAACAGTGCTCAATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018652
GOLGA6B MISSION shRNA shRNA Plasmid DNA
golgin A6 family, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018652.4-2294s21c1
Sequence:CCGGATGCTAGAGCCACTCACATTTCTCGAGAAATGTGAGTGGCTCTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018652.4-2271s21c1
Sequence:CCGGCACAATTCATTTACTCCATTTCTCGAGAAATGGAGTAAATGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-1388s1c1
Sequence:CCGGCGAGGATCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-936s1c1
Sequence:CCGGCAGCTACAAGATGAGGCCAAACTCGAGTTTGGCCTCATCTTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018652.2-330s1c1
Sequence:CCGGCAGCAGAAGAAACAAGTGGAACTCGAGTTCCACTTGTTTCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-528s1c1
Sequence:CCGGCAATACTCCTTACAGCGTATTCTCGAGAATACGCTGTAAGGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-816s1c1
Sequence:CCGGGAAGAGAAGAAGCGTGACATACTCGAGTATGTCACGCTTCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018652.2-723s1c1
Sequence:CCGGGAGCGAGACGAATATGCTAAACTCGAGTTTAGCATATTCGTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018652.2-2669s1c1
Sequence:CCGGCCCTCAATTGAGCACTGTTTACTCGAGTAAACAGTGCTCAATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018652
GOLGA6B MISSION shRNA Lentiviral Transduction Particles
golgin A6 family, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018652.4-2294s21c1
Sequence:CCGGATGCTAGAGCCACTCACATTTCTCGAGAAATGTGAGTGGCTCTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018652.4-2271s21c1
Sequence:CCGGCACAATTCATTTACTCCATTTCTCGAGAAATGGAGTAAATGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-1388s1c1
Sequence:CCGGCGAGGATCTGAACAACGAGAACTCGAGTTCTCGTTGTTCAGATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-936s1c1
Sequence:CCGGCAGCTACAAGATGAGGCCAAACTCGAGTTTGGCCTCATCTTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018652.2-330s1c1
Sequence:CCGGCAGCAGAAGAAACAAGTGGAACTCGAGTTCCACTTGTTTCTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-528s1c1
Sequence:CCGGCAATACTCCTTACAGCGTATTCTCGAGAATACGCTGTAAGGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018652.2-816s1c1
Sequence:CCGGGAAGAGAAGAAGCGTGACATACTCGAGTATGTCACGCTTCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018652.2-723s1c1
Sequence:CCGGGAGCGAGACGAATATGCTAAACTCGAGTTTAGCATATTCGTCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018652.2-2669s1c1
Sequence:CCGGCCCTCAATTGAGCACTGTTTACTCGAGTAAACAGTGCTCAATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks