EMAIL THIS PAGE TO A FRIEND

GOLGA6D

golgin A6 family, member D

8 Gene Product Result for
Species: Human GOLGA6D(653643)
UniProtKB ID: P0CG33
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145224 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_370876 Rosetta Predictions human pricing
XM_934956 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479269 predicted 1771
2 SASI_Hs01_00259287 predicted 74
3 SASI_Hs02_00479270 predicted 385
4 SASI_Hs01_00259288 predicted 512
5 SASI_Hs02_00479271 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269205 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145224
GOLGA6D MISSION shRNA Bacterial Glycerol Stock
golgin A6 family, member D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-1731s21c1
Sequence:CCGGAGAGAGTCCTTCACCGTATATCTCGAGATATACGGTGAAGGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-522s21c1
Sequence:CCGGCAATACTCCTTACAGCATATTCTCGAGAATATGCTGTAAGGAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-633s21c1
Sequence:CCGGCGGTTACAGCAGACCATAAAGCTCGAGCTTTATGGTCTGCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-711s21c1
Sequence:CCGGCAGCTAGAGCGAGACGAATATCTCGAGATATTCGTCTCGCTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145224.1-2169s21c1
Sequence:CCGGGCCGAGAACAGGGAGATAAACCTCGAGGTTTATCTCCCTGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145224
GOLGA6D MISSION shRNA shRNA Plasmid DNA
golgin A6 family, member D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-1731s21c1
Sequence:CCGGAGAGAGTCCTTCACCGTATATCTCGAGATATACGGTGAAGGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-522s21c1
Sequence:CCGGCAATACTCCTTACAGCATATTCTCGAGAATATGCTGTAAGGAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-633s21c1
Sequence:CCGGCGGTTACAGCAGACCATAAAGCTCGAGCTTTATGGTCTGCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-711s21c1
Sequence:CCGGCAGCTAGAGCGAGACGAATATCTCGAGATATTCGTCTCGCTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145224.1-2169s21c1
Sequence:CCGGGCCGAGAACAGGGAGATAAACCTCGAGGTTTATCTCCCTGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145224
GOLGA6D MISSION shRNA Lentiviral Transduction Particles
golgin A6 family, member D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-1731s21c1
Sequence:CCGGAGAGAGTCCTTCACCGTATATCTCGAGATATACGGTGAAGGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-522s21c1
Sequence:CCGGCAATACTCCTTACAGCATATTCTCGAGAATATGCTGTAAGGAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-633s21c1
Sequence:CCGGCGGTTACAGCAGACCATAAAGCTCGAGCTTTATGGTCTGCTGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145224.1-711s21c1
Sequence:CCGGCAGCTAGAGCGAGACGAATATCTCGAGATATTCGTCTCGCTCTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145224.1-2169s21c1
Sequence:CCGGGCCGAGAACAGGGAGATAAACCTCGAGGTTTATCTCCCTGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks