EMAIL THIS PAGE TO A FRIEND

GOLGA6L2

golgin A6 family-like 2

Synonyms: CT105
Species: Human GOLGA6L2(283685)
UniProtKB ID: Q8N9W4, A1L301
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182561 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182561 Rosetta Predictions human pricing
XR_040632 Rosetta Predictions human pricing
XR_040633 Rosetta Predictions human pricing
XR_040634 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115455 predicted 400
2 SASI_Hs01_00115456 predicted 378
3 SASI_Hs01_00115457 predicted 415
4 SASI_Hs01_00115458 predicted 480
5 SASI_Hs01_00115459 predicted 336
6 SASI_Hs01_00115460 predicted 365
7 SASI_Hs01_00115461 predicted 628
8 SASI_Hs01_00115462 predicted 1796
9 SASI_Hs01_00115463 predicted 1942
10 SASI_Hs01_00115464 predicted 2043
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520579 predicted 395
2 SASI_Hs02_00520580 predicted 637
3 SASI_Hs02_00520581 predicted 371
4 SASI_Hs02_00520582 predicted 403
5 SASI_Hs02_00520583 predicted 481
6 SASI_Hs02_00520584 predicted 888
7 SASI_Hs02_00520585 predicted 905
8 SASI_Hs02_00520586 predicted 9
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520587 predicted 253
2 SASI_Hs02_00520588 predicted 241
3 SASI_Hs02_00520589 predicted 304
4 SASI_Hs02_00520590 predicted 461
5 SASI_Hs02_00520591 predicted 445
6 SASI_Hs02_00520592 predicted 276
7 SASI_Hs02_00520593 predicted 318
8 SASI_Hs02_00520594 predicted 371
9 SASI_Hs02_00520595 predicted 236
10 SASI_Hs02_00520596 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520597 predicted 397
2 SASI_Hs02_00520598 predicted 645
3 SASI_Hs02_00520599 predicted 369
4 SASI_Hs02_00520600 predicted 406
5 SASI_Hs02_00520601 predicted 477
6 SASI_Hs02_00520602 predicted 331
7 SASI_Hs02_00520603 predicted 363
8 SASI_Hs02_00520604 predicted 616
9 SASI_Hs02_00520605 predicted 759
10 SASI_Hs02_00520606 predicted 2662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182561
GOLGA6L2 MISSION shRNA Bacterial Glycerol Stock
golgin A6 family-like 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182561.1-354s1c1
Sequence:CCGGGAGGCCCAGGATCATACAATACTCGAGTATTGTATGATCCTGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-266s1c1
Sequence:CCGGGCCTGAGGATACACAACAGAACTCGAGTTCTGTTGTGTATCCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-797s1c1
Sequence:CCGGGCTCAACGTGAAGGAGCTAAACTCGAGTTTAGCTCCTTCACGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-1718s1c1
Sequence:CCGGGATACGAGATCAGAAAGAGAACTCGAGTTCTCTTTCTGATCTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-1806s1c1
Sequence:CCGGCTTTGTAATATGAGCCACACTCTCGAGAGTGTGGCTCATATTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-359s1c1
Sequence:CCGGCCAGGATCATACAATACGAATCTCGAGATTCGTATTGTATGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182561
GOLGA6L2 MISSION shRNA shRNA Plasmid DNA
golgin A6 family-like 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182561.1-354s1c1
Sequence:CCGGGAGGCCCAGGATCATACAATACTCGAGTATTGTATGATCCTGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-266s1c1
Sequence:CCGGGCCTGAGGATACACAACAGAACTCGAGTTCTGTTGTGTATCCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-797s1c1
Sequence:CCGGGCTCAACGTGAAGGAGCTAAACTCGAGTTTAGCTCCTTCACGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-1718s1c1
Sequence:CCGGGATACGAGATCAGAAAGAGAACTCGAGTTCTCTTTCTGATCTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-1806s1c1
Sequence:CCGGCTTTGTAATATGAGCCACACTCTCGAGAGTGTGGCTCATATTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-359s1c1
Sequence:CCGGCCAGGATCATACAATACGAATCTCGAGATTCGTATTGTATGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182561
GOLGA6L2 MISSION shRNA Lentiviral Transduction Particles
golgin A6 family-like 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182561.1-354s1c1
Sequence:CCGGGAGGCCCAGGATCATACAATACTCGAGTATTGTATGATCCTGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-266s1c1
Sequence:CCGGGCCTGAGGATACACAACAGAACTCGAGTTCTGTTGTGTATCCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-797s1c1
Sequence:CCGGGCTCAACGTGAAGGAGCTAAACTCGAGTTTAGCTCCTTCACGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-1718s1c1
Sequence:CCGGGATACGAGATCAGAAAGAGAACTCGAGTTCTCTTTCTGATCTCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-1806s1c1
Sequence:CCGGCTTTGTAATATGAGCCACACTCTCGAGAGTGTGGCTCATATTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182561.1-359s1c1
Sequence:CCGGCCAGGATCATACAATACGAATCTCGAGATTCGTATTGTATGATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks