EMAIL THIS PAGE TO A FRIEND

GOLGA6L6

golgin A6 family-like 6

12 Gene Product Result for
Species: Human GOLGA6L6(727832)
UniProtKB ID: A8MZA4, D3YTC0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145004 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_037552 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00502153 predicted 657
2 SASI_Hs02_00502154 predicted 503
3 SASI_Hs02_00502155 predicted 586
4 SASI_Hs02_00502156 predicted 508
5 SASI_Hs02_00502157 predicted 626
6 SASI_Hs02_00502158 predicted 662
7 SASI_Hs02_00502159 predicted 597
8 SASI_Hs02_00502160 predicted 593
9 SASI_Hs02_00502161 predicted 519
10 SASI_Hs02_00502162 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145004
GOLGA6L6 MISSION shRNA Bacterial Glycerol Stock
golgin A6 family-like 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-1750s21c1
Sequence:CCGGGCATGAGCAGGAGAAGATATGCTCGAGCATATCTTCTCCTGCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145004.1-2541s21c1
Sequence:CCGGGCCTGTAATCCTAGCAATTTGCTCGAGCAAATTGCTAGGATTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-657s21c1
Sequence:CCGGAGAAGGCGGATAGGTACATTGCTCGAGCAATGTACCTATCCGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-1546s21c1
Sequence:CCGGTCACGAGCAGGAGGAGATATGCTCGAGCATATCTCCTCCTGCTCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-805s21c1
Sequence:CCGGTGAGATCCAGCTCAACGTAAACTCGAGTTTACGTTGAGCTGGATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145004
GOLGA6L6 MISSION shRNA shRNA Plasmid DNA
golgin A6 family-like 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-1750s21c1
Sequence:CCGGGCATGAGCAGGAGAAGATATGCTCGAGCATATCTTCTCCTGCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145004.1-2541s21c1
Sequence:CCGGGCCTGTAATCCTAGCAATTTGCTCGAGCAAATTGCTAGGATTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-657s21c1
Sequence:CCGGAGAAGGCGGATAGGTACATTGCTCGAGCAATGTACCTATCCGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-1546s21c1
Sequence:CCGGTCACGAGCAGGAGGAGATATGCTCGAGCATATCTCCTCCTGCTCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-805s21c1
Sequence:CCGGTGAGATCCAGCTCAACGTAAACTCGAGTTTACGTTGAGCTGGATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145004
GOLGA6L6 MISSION shRNA Lentiviral Transduction Particles
golgin A6 family-like 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-1750s21c1
Sequence:CCGGGCATGAGCAGGAGAAGATATGCTCGAGCATATCTTCTCCTGCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145004.1-2541s21c1
Sequence:CCGGGCCTGTAATCCTAGCAATTTGCTCGAGCAAATTGCTAGGATTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-657s21c1
Sequence:CCGGAGAAGGCGGATAGGTACATTGCTCGAGCAATGTACCTATCCGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-1546s21c1
Sequence:CCGGTCACGAGCAGGAGGAGATATGCTCGAGCATATCTCCTCCTGCTCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145004.1-805s21c1
Sequence:CCGGTGAGATCCAGCTCAACGTAAACTCGAGTTTACGTTGAGCTGGATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)