EMAIL THIS PAGE TO A FRIEND

GOLGA6L9

golgin A6 family-like 9

14 Gene Product Result for
Species: Human GOLGA6L9(440295)
UniProtKB ID: A6NEM1, Q8IVV3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305807 ANTI-GOLGA6L9(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198181 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198181 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371709 predicted 1855
2 SASI_Hs02_00371710 predicted 1171
3 SASI_Hs02_00371711 predicted 205
4 SASI_Hs02_00371712 predicted 389
5 SASI_Hs02_00371713 predicted 386
6 SASI_Hs02_00371714 predicted 495
7 SASI_Hs02_00371715 predicted 475
8 SASI_Hs02_00371716 predicted 460
9 SASI_Hs02_00371717 predicted 389
10 SASI_Hs02_00371718 predicted 466
11 SASI_Hs01_00098596 predicted 1571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198181
GOLGA6L9 MISSION shRNA Bacterial Glycerol Stock
golgin A6 family-like 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-1363s21c1
Sequence:CCGGTGCCGAGAACAGGGAGCTAAACTCGAGTTTAGCTCCCTGTTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-850s21c1
Sequence:CCGGAGAGGTGGAGAAGCTGTTAAACTCGAGTTTAACAGCTTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198181.2-3184s21c1
Sequence:CCGGTTTACCCTGACACGTATAAATCTCGAGATTTATACGTGTCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-1127s21c1
Sequence:CCGGCAGTTGGAGCAGCAAGTAAAGCTCGAGCTTTACTTGCTGCTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-394s21c1
Sequence:CCGGGGATTCAAGCTCCGCAATAATCTCGAGATTATTGCGGAGCTTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183094    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198181.1-2732s1c1
Sequence:CCGGCCTCACAAAGTTCTTTACAAACTCGAGTTTGTAAAGAACTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198181.1-719s1c1
Sequence:CCGGGAGGTGGAGAAGCTGTTAGAACTCGAGTTCTAACAGCTTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198181.1-1006s1c1
Sequence:CCGGGCAAGTAAAGGAGCTGGAGAACTCGAGTTCTCCAGCTCCTTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198181
GOLGA6L9 MISSION shRNA shRNA Plasmid DNA
golgin A6 family-like 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-1363s21c1
Sequence:CCGGTGCCGAGAACAGGGAGCTAAACTCGAGTTTAGCTCCCTGTTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-850s21c1
Sequence:CCGGAGAGGTGGAGAAGCTGTTAAACTCGAGTTTAACAGCTTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198181.2-3184s21c1
Sequence:CCGGTTTACCCTGACACGTATAAATCTCGAGATTTATACGTGTCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-1127s21c1
Sequence:CCGGCAGTTGGAGCAGCAAGTAAAGCTCGAGCTTTACTTGCTGCTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-394s21c1
Sequence:CCGGGGATTCAAGCTCCGCAATAATCTCGAGATTATTGCGGAGCTTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183094    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198181.1-2732s1c1
Sequence:CCGGCCTCACAAAGTTCTTTACAAACTCGAGTTTGTAAAGAACTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198181.1-719s1c1
Sequence:CCGGGAGGTGGAGAAGCTGTTAGAACTCGAGTTCTAACAGCTTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198181.1-1006s1c1
Sequence:CCGGGCAAGTAAAGGAGCTGGAGAACTCGAGTTCTCCAGCTCCTTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198181
GOLGA6L9 MISSION shRNA Lentiviral Transduction Particles
golgin A6 family-like 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-1363s21c1
Sequence:CCGGTGCCGAGAACAGGGAGCTAAACTCGAGTTTAGCTCCCTGTTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-850s21c1
Sequence:CCGGAGAGGTGGAGAAGCTGTTAAACTCGAGTTTAACAGCTTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198181.2-3184s21c1
Sequence:CCGGTTTACCCTGACACGTATAAATCTCGAGATTTATACGTGTCAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-1127s21c1
Sequence:CCGGCAGTTGGAGCAGCAAGTAAAGCTCGAGCTTTACTTGCTGCTCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198181.2-394s21c1
Sequence:CCGGGGATTCAAGCTCCGCAATAATCTCGAGATTATTGCGGAGCTTGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183094    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198181.1-2732s1c1
Sequence:CCGGCCTCACAAAGTTCTTTACAAACTCGAGTTTGTAAAGAACTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198181.1-719s1c1
Sequence:CCGGGAGGTGGAGAAGCTGTTAGAACTCGAGTTCTAACAGCTTCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198181.1-1006s1c1
Sequence:CCGGGCAAGTAAAGGAGCTGGAGAACTCGAGTTCTCCAGCTCCTTTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks