EMAIL THIS PAGE TO A FRIEND

GOLGA7

golgin A7

Synonyms: GCP16 GOLGA3AP1 GOLGA7A HSPC041
UniProtKB ID: Q7Z5G4, D3DSX9, J3KQ24, Q96EQ4, Q9P1S0, Q9Y5U7
Gene ID:
Mouse(57437) golgi autoantigen, golgin subfamily a, 7
Rat(361171) golgin A7
Zebrafish(798622) golgi autoantigen, golgin subfamily a, 7
chicken(426787) golgin A7
cow(616809) golgin A7
dog(607476) golgin A7
sheep(101116535) golgin A7
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002296 Rosetta Predictions human pricing
NM_016099 Rosetta Predictions human pricing
NM_001007731 Rosetta Predictions rat pricing
NM_001042484 Rosetta Predictions mouse pricing
NM_020585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121801 predicted 389
2 SASI_Hs01_00121803 predicted 444
3 SASI_Hs01_00121804 predicted 594
4 SASI_Hs02_00304188 predicted 590
5 SASI_Hs01_00121806 predicted 387
6 SASI_Hs01_00121807 predicted 609
7 SASI_Hs02_00304189 predicted 385
8 SASI_Hs01_00121802 predicted 433
9 SASI_Hs01_00121805 predicted 409
10 SASI_Hs01_00121808 predicted 470
11 SASI_Hs01_00121809 predicted 565
12 SASI_Hs01_00121810 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226404 predicted 267
2 SASI_Hs01_00226406 predicted 320
3 SASI_Hs01_00226407 predicted 479
4 SASI_Hs02_00348869 predicted 471
5 SASI_Hs01_00226409 predicted 262
6 SASI_Hs01_00226410 predicted 486
7 SASI_Hs02_00348870 predicted 259
8 SASI_Hs01_00226405 predicted 311
9 SASI_Hs01_00226408 predicted 286
10 SASI_Hs01_00226411 predicted 342
11 SASI_Hs01_00226412 predicted 442
12 SASI_Hs01_00226413 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115276 predicted 571
2 SASI_Rn01_00115277 predicted 320
3 SASI_Rn01_00115278 predicted 463
4 SASI_Rn01_00115280 predicted 621
5 SASI_Rn01_00115281 predicted 482
6 SASI_Rn01_00115282 predicted 450
7 SASI_Rn01_00115283 predicted 1117
8 SASI_Rn01_00115284 predicted 785
9 SASI_Rn02_00198917 predicted 844
10 SASI_Rn01_00115285 predicted 708
11 SASI_Rn01_00115279 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290395 predicted 310
2 SASI_Mm02_00290396 predicted 887
3 SASI_Mm02_00290397 predicted 978
4 SASI_Mm02_00290398 predicted 443
5 SASI_Mm02_00290399 predicted 268
6 SASI_Mm02_00290400 predicted 574
7 SASI_Mm02_00290401 predicted 652
8 SASI_Mm02_00290402 predicted 969
9 SASI_Mm02_00290403 predicted 350
10 SASI_Mm02_00290404 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325663 predicted 526
2 SASI_Mm02_00325664 predicted 1095
3 SASI_Mm02_00325665 predicted 1195
4 SASI_Mm01_00151402 predicted 648
5 SASI_Mm02_00325666 predicted 480
6 SASI_Mm02_00325667 predicted 792
7 SASI_Mm02_00325668 predicted 862
8 SASI_Mm02_00325669 predicted 1189
9 SASI_Mm02_00325670 predicted 568
10 SASI_Mm02_00325671 predicted 1072
11 SASI_Mm01_00151403 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020585
VALIDATED
GOLGA7 MISSION shRNA Bacterial Glycerol Stock
golgin A7
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-1309s1c1
Sequence:CCGGGCTTGTTCATTCCACAGATAACTCGAGTTATCTGTGGAATGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-351s1c1
Sequence:CCGGCAGCAGTTTGAAGAAACAGTTCTCGAGAACTGTTTCTTCAAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-387s1c1
Sequence:CCGGCTTTATGCAGAAGCAGAGAAACTCGAGTTTCTCTGCTTCTGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-360s1c1
Sequence:CCGGGAAGAAACAGTTCGAACTCTACTCGAGTAGAGTTCGAACTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020585.1-1036s1c1
Sequence:CCGGCCAGATTAGTAAGCAGGCTTTCTCGAGAAAGCCTGCTTACTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020585.1-495s1c1
Sequence:CCGGGTCTTGAAGAAAGTCTCCAAACTCGAGTTTGGAGACTTTCTTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020585.2-591s1c1
Sequence:CCGGGAACAGAATGAGAAGATATATCTCGAGATATATCTTCTCATTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020585.2-1794s1c1
Sequence:CCGGGAGATACTGTAGGTGCTAATACTCGAGTATTAGCACCTACAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-453s21c1
Sequence:CCGGCTTTATGCAGAAGCAGAGAAACTCGAGTTTCTCTGCTTCTGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-417s21c1
Sequence:CCGGCAGCAGTTTGAAGAAACAGTTCTCGAGAACTGTTTCTTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020585.2-1373s21c1
Sequence:CCGGGCTTGTTCATTCCACAGATAACTCGAGTTATCTGTGGAATGAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-426s21c1
Sequence:CCGGGAAGAAACAGTTCGAACTCTACTCGAGTAGAGTTCGAACTGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-326s21c1
Sequence:CCGGGAAGGTGTTCATTCAGCGAGACTCGAGTCTCGCTGAATGAACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020585
VALIDATED
GOLGA7 MISSION shRNA shRNA Plasmid DNA
golgin A7
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-1309s1c1
Sequence:CCGGGCTTGTTCATTCCACAGATAACTCGAGTTATCTGTGGAATGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-351s1c1
Sequence:CCGGCAGCAGTTTGAAGAAACAGTTCTCGAGAACTGTTTCTTCAAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-387s1c1
Sequence:CCGGCTTTATGCAGAAGCAGAGAAACTCGAGTTTCTCTGCTTCTGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-360s1c1
Sequence:CCGGGAAGAAACAGTTCGAACTCTACTCGAGTAGAGTTCGAACTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020585.1-1036s1c1
Sequence:CCGGCCAGATTAGTAAGCAGGCTTTCTCGAGAAAGCCTGCTTACTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020585.1-495s1c1
Sequence:CCGGGTCTTGAAGAAAGTCTCCAAACTCGAGTTTGGAGACTTTCTTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020585.2-591s1c1
Sequence:CCGGGAACAGAATGAGAAGATATATCTCGAGATATATCTTCTCATTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020585.2-1794s1c1
Sequence:CCGGGAGATACTGTAGGTGCTAATACTCGAGTATTAGCACCTACAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-453s21c1
Sequence:CCGGCTTTATGCAGAAGCAGAGAAACTCGAGTTTCTCTGCTTCTGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-417s21c1
Sequence:CCGGCAGCAGTTTGAAGAAACAGTTCTCGAGAACTGTTTCTTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020585.2-1373s21c1
Sequence:CCGGGCTTGTTCATTCCACAGATAACTCGAGTTATCTGTGGAATGAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-426s21c1
Sequence:CCGGGAAGAAACAGTTCGAACTCTACTCGAGTAGAGTTCGAACTGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-326s21c1
Sequence:CCGGGAAGGTGTTCATTCAGCGAGACTCGAGTCTCGCTGAATGAACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020585
VALIDATED
GOLGA7 MISSION shRNA Lentiviral Transduction Particles
golgin A7
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-1309s1c1
Sequence:CCGGGCTTGTTCATTCCACAGATAACTCGAGTTATCTGTGGAATGAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-351s1c1
Sequence:CCGGCAGCAGTTTGAAGAAACAGTTCTCGAGAACTGTTTCTTCAAACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-387s1c1
Sequence:CCGGCTTTATGCAGAAGCAGAGAAACTCGAGTTTCTCTGCTTCTGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020585.1-360s1c1
Sequence:CCGGGAAGAAACAGTTCGAACTCTACTCGAGTAGAGTTCGAACTGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020585.1-1036s1c1
Sequence:CCGGCCAGATTAGTAAGCAGGCTTTCTCGAGAAAGCCTGCTTACTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020585.1-495s1c1
Sequence:CCGGGTCTTGAAGAAAGTCTCCAAACTCGAGTTTGGAGACTTTCTTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020585.2-591s1c1
Sequence:CCGGGAACAGAATGAGAAGATATATCTCGAGATATATCTTCTCATTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020585.2-1794s1c1
Sequence:CCGGGAGATACTGTAGGTGCTAATACTCGAGTATTAGCACCTACAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-453s21c1
Sequence:CCGGCTTTATGCAGAAGCAGAGAAACTCGAGTTTCTCTGCTTCTGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-417s21c1
Sequence:CCGGCAGCAGTTTGAAGAAACAGTTCTCGAGAACTGTTTCTTCAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020585.2-1373s21c1
Sequence:CCGGGCTTGTTCATTCCACAGATAACTCGAGTTATCTGTGGAATGAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-426s21c1
Sequence:CCGGGAAGAAACAGTTCGAACTCTACTCGAGTAGAGTTCGAACTGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_020585.2-326s21c1
Sequence:CCGGGAAGGTGTTCATTCAGCGAGACTCGAGTCTCGCTGAATGAACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016099
VALIDATED
GOLGA7 MISSION shRNA Bacterial Glycerol Stock
golgin A7
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-395s1c1
Sequence:CCGGGAGGACTGCGAGTTATTGAAACTCGAGTTTCAATAACTCGCAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-346s1c1
Sequence:CCGGGAGAAGATCTATGCTCCACAACTCGAGTTGTGGAGCATAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-198s1c1
Sequence:CCGGCCTTTATGCAGAAGCAGAGAACTCGAGTTCTCTGCTTCTGCATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-231s1c1
Sequence:CCGGGTCATATCTCGAAGGTTGTTTCTCGAGAAACAACCTTCGAGATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-241s1c1
Sequence:CCGGGAAGGTTGTTTGGCTTGTTTACTCGAGTAAACAAGCCAAACAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-420s1c1
Sequence:CCGGCATTTATGAAGACAGAGGCATCTCGAGATGCCTCTGTCTTCATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-263s1c1
Sequence:CCGGCAGCATATACCATCTTCCTATCTCGAGATAGGAAGATGGTATATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016099.1-248s1c1
Sequence:CCGGGTTTGGCTTGTTTAACAGCATCTCGAGATGCTGTTAAACAAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-337s1c1
Sequence:CCGGGAGCAGAATGAGAAGATCTATCTCGAGATAGATCTTCTCATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-272s1c1
Sequence:CCGGCCATCTTCCTATGCATGGAAACTCGAGTTTCCATGCATAGGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016099.1-240s1c1
Sequence:CCGGCGAAGGTTGTTTGGCTTGTTTCTCGAGAAACAAGCCAAACAACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-234s21c1
Sequence:CCGGCCTTTATGCAGAAGCAGAGAACTCGAGTTCTCTGCTTCTGCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-267s21c1
Sequence:CCGGGTCATATCTCGAAGGTTGTTTCTCGAGAAACAACCTTCGAGATATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-373s21c1
Sequence:CCGGGAGCAGAATGAGAAGATCTATCTCGAGATAGATCTTCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-284s21c1
Sequence:CCGGGTTTGGCTTGTTTAACAGCATCTCGAGATGCTGTTAAACAAGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016099
VALIDATED
GOLGA7 MISSION shRNA shRNA Plasmid DNA
golgin A7
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-395s1c1
Sequence:CCGGGAGGACTGCGAGTTATTGAAACTCGAGTTTCAATAACTCGCAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-346s1c1
Sequence:CCGGGAGAAGATCTATGCTCCACAACTCGAGTTGTGGAGCATAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-198s1c1
Sequence:CCGGCCTTTATGCAGAAGCAGAGAACTCGAGTTCTCTGCTTCTGCATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-231s1c1
Sequence:CCGGGTCATATCTCGAAGGTTGTTTCTCGAGAAACAACCTTCGAGATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-241s1c1
Sequence:CCGGGAAGGTTGTTTGGCTTGTTTACTCGAGTAAACAAGCCAAACAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-420s1c1
Sequence:CCGGCATTTATGAAGACAGAGGCATCTCGAGATGCCTCTGTCTTCATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-263s1c1
Sequence:CCGGCAGCATATACCATCTTCCTATCTCGAGATAGGAAGATGGTATATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016099.1-248s1c1
Sequence:CCGGGTTTGGCTTGTTTAACAGCATCTCGAGATGCTGTTAAACAAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-337s1c1
Sequence:CCGGGAGCAGAATGAGAAGATCTATCTCGAGATAGATCTTCTCATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-272s1c1
Sequence:CCGGCCATCTTCCTATGCATGGAAACTCGAGTTTCCATGCATAGGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016099.1-240s1c1
Sequence:CCGGCGAAGGTTGTTTGGCTTGTTTCTCGAGAAACAAGCCAAACAACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-234s21c1
Sequence:CCGGCCTTTATGCAGAAGCAGAGAACTCGAGTTCTCTGCTTCTGCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-267s21c1
Sequence:CCGGGTCATATCTCGAAGGTTGTTTCTCGAGAAACAACCTTCGAGATATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-373s21c1
Sequence:CCGGGAGCAGAATGAGAAGATCTATCTCGAGATAGATCTTCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-284s21c1
Sequence:CCGGGTTTGGCTTGTTTAACAGCATCTCGAGATGCTGTTAAACAAGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016099
VALIDATED
GOLGA7 MISSION shRNA Lentiviral Transduction Particles
golgin A7
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-395s1c1
Sequence:CCGGGAGGACTGCGAGTTATTGAAACTCGAGTTTCAATAACTCGCAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-346s1c1
Sequence:CCGGGAGAAGATCTATGCTCCACAACTCGAGTTGTGGAGCATAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-198s1c1
Sequence:CCGGCCTTTATGCAGAAGCAGAGAACTCGAGTTCTCTGCTTCTGCATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-231s1c1
Sequence:CCGGGTCATATCTCGAAGGTTGTTTCTCGAGAAACAACCTTCGAGATATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-241s1c1
Sequence:CCGGGAAGGTTGTTTGGCTTGTTTACTCGAGTAAACAAGCCAAACAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-420s1c1
Sequence:CCGGCATTTATGAAGACAGAGGCATCTCGAGATGCCTCTGTCTTCATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016099.1-263s1c1
Sequence:CCGGCAGCATATACCATCTTCCTATCTCGAGATAGGAAGATGGTATATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016099.1-248s1c1
Sequence:CCGGGTTTGGCTTGTTTAACAGCATCTCGAGATGCTGTTAAACAAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016099.1-337s1c1
Sequence:CCGGGAGCAGAATGAGAAGATCTATCTCGAGATAGATCTTCTCATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016099.1-272s1c1
Sequence:CCGGCCATCTTCCTATGCATGGAAACTCGAGTTTCCATGCATAGGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016099.1-240s1c1
Sequence:CCGGCGAAGGTTGTTTGGCTTGTTTCTCGAGAAACAAGCCAAACAACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-234s21c1
Sequence:CCGGCCTTTATGCAGAAGCAGAGAACTCGAGTTCTCTGCTTCTGCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-267s21c1
Sequence:CCGGGTCATATCTCGAAGGTTGTTTCTCGAGAAACAACCTTCGAGATATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-373s21c1
Sequence:CCGGGAGCAGAATGAGAAGATCTATCTCGAGATAGATCTTCTCATTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016099.2-284s21c1
Sequence:CCGGGTTTGGCTTGTTTAACAGCATCTCGAGATGCTGTTAAACAAGCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks