EMAIL THIS PAGE TO A FRIEND

GOLGA7B

golgin A7 family, member B

56 Gene Product Result for
Synonyms: C10orf132 C10orf133 bA451M19.3 bA459F3.4
UniProtKB ID: Q2TAP0, Q5T4F5
Gene ID:
Mouse(71146) golgi autoantigen, golgin subfamily a, 7B
Rat(309378) golgin A7 family, member B
sheep(101116877) golgin A7 family, member B
domestic guinea pig(101787889) golgin A7 family, member B
naked mole-rat(101707411) golgin A7 family, member B
dog(100683677) golgin A7 family, member B
domestic cat(101082266) golgin A7 family, member B
cow(767832) golgin A7 family, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV54406 Anti-C10ORF132 antibody produced in rabbit affinity isolated antibody zebrafish, rat, horse, bovine, human, mouse, guinea pig, rabbit
western blot pricing
SAB2107059 Anti-C10ORF132 antibody produced in rabbit affinity isolated antibody human, horse, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151151 MISSION® esiRNA esiRNA human GOLGA7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010917 Rosetta Predictions human pricing
XM_001055463 Rosetta Predictions rat pricing
XM_219889 Rosetta Predictions rat pricing
NM_027694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041387 predicted 925
2 SASI_Hs01_00041388 predicted 201
3 SASI_Hs01_00041389 predicted 201
4 SASI_Hs01_00041390 predicted 226
5 SASI_Hs01_00041391 predicted 757
6 SASI_Hs02_00305907 predicted 808
7 SASI_Hs01_00041392 predicted 451
8 SASI_Hs01_00041394 predicted 109
9 SASI_Hs01_00041395 predicted 367
10 SASI_Hs01_00041396 predicted 435
11 SASI_Hs01_00041393 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279611 predicted 587
2 SASI_Rn02_00279612 predicted 622
3 SASI_Rn02_00279613 predicted 475
4 SASI_Rn02_00279614 predicted 602
5 SASI_Rn02_00279615 predicted 478
6 SASI_Rn02_00279616 predicted 658
7 SASI_Rn02_00279617 predicted 617
8 SASI_Rn02_00279618 predicted 726
9 SASI_Rn02_00279619 predicted 617
10 SASI_Rn02_00279620 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378809 predicted 9
2 SASI_Rn02_00378810 predicted 902
3 SASI_Rn02_00378811 predicted 427
4 SASI_Rn02_00378812 predicted 382
5 SASI_Rn02_00378813 predicted 790
6 SASI_Rn02_00378814 predicted 904
7 SASI_Rn02_00378815 predicted 574
8 SASI_Rn02_00378816 predicted 683
9 SASI_Rn02_00378817 predicted 897
10 SASI_Rn02_00378818 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029000 predicted 547
2 SASI_Mm01_00029001 predicted 525
3 SASI_Mm01_00029002 predicted 1365
4 SASI_Mm01_00029003 predicted 435
5 SASI_Mm02_00332579 predicted 410
6 SASI_Mm02_00332580 predicted 762
7 SASI_Mm01_00029004 predicted 1293
8 SASI_Mm01_00029005 predicted 1244
9 SASI_Mm02_00332581 predicted 1187
10 SASI_Mm01_00029006 predicted 521
11 SASI_Mm01_00029007 predicted 1257
12 SASI_Mm01_00029008 predicted 1273
13 SASI_Mm01_00029009 predicted 785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010917
GOLGA7B MISSION shRNA Bacterial Glycerol Stock
golgin A7 family, member B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-215s1c1
Sequence:CCGGGCTCTTTGAAGAGACTGTGAACTCGAGTTCACAGTCTCTTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-344s1c1
Sequence:CCGGCCACTATGAGAAGGTTCTCAACTCGAGTTGAGAACCTTCTCATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010917.1-1025s1c1
Sequence:CCGGCCAGTATCTGTTCCTTCTCATCTCGAGATGAGAAGGAACAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-362s1c1
Sequence:CCGGCAAGAAGATTTCCCGCTACATCTCGAGATGTAGCGGGAAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-158s1c1
Sequence:CCGGCATCTGTCAGTTCCAGACCAACTCGAGTTGGTCTGGAACTGACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-396s1c1
Sequence:CCGGGAGAAGATCTTTGCACCTCGACTCGAGTCGAGGTGCAAAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-339s1c1
Sequence:CCGGGAGACCCACTATGAGAAGGTTCTCGAGAACCTTCTCATAGTGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-231s1c1
Sequence:CCGGGTGAAGACCCTCAACGGATTTCTCGAGAAATCCGTTGAGGGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-122s1c1
Sequence:CCGGCAAGGTCTTTATCCAGAGAGACTCGAGTCTCTCTGGATAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010917.1-1352s1c1
Sequence:CCGGGCCAGTTTCCTGAGATTAGAACTCGAGTTCTAATCTCAGGAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010917.1-1817s1c1
Sequence:CCGGCCCTGTAAGTAAATGTCCAAACTCGAGTTTGGACATTTACTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-387s1c1
Sequence:CCGGGAGCAGAATGAGAAGATCTTTCTCGAGAAAGATCTTCTCATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010917
GOLGA7B MISSION shRNA shRNA Plasmid DNA
golgin A7 family, member B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-215s1c1
Sequence:CCGGGCTCTTTGAAGAGACTGTGAACTCGAGTTCACAGTCTCTTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-344s1c1
Sequence:CCGGCCACTATGAGAAGGTTCTCAACTCGAGTTGAGAACCTTCTCATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010917.1-1025s1c1
Sequence:CCGGCCAGTATCTGTTCCTTCTCATCTCGAGATGAGAAGGAACAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-362s1c1
Sequence:CCGGCAAGAAGATTTCCCGCTACATCTCGAGATGTAGCGGGAAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-158s1c1
Sequence:CCGGCATCTGTCAGTTCCAGACCAACTCGAGTTGGTCTGGAACTGACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-396s1c1
Sequence:CCGGGAGAAGATCTTTGCACCTCGACTCGAGTCGAGGTGCAAAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-339s1c1
Sequence:CCGGGAGACCCACTATGAGAAGGTTCTCGAGAACCTTCTCATAGTGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-231s1c1
Sequence:CCGGGTGAAGACCCTCAACGGATTTCTCGAGAAATCCGTTGAGGGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-122s1c1
Sequence:CCGGCAAGGTCTTTATCCAGAGAGACTCGAGTCTCTCTGGATAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010917.1-1352s1c1
Sequence:CCGGGCCAGTTTCCTGAGATTAGAACTCGAGTTCTAATCTCAGGAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010917.1-1817s1c1
Sequence:CCGGCCCTGTAAGTAAATGTCCAAACTCGAGTTTGGACATTTACTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-387s1c1
Sequence:CCGGGAGCAGAATGAGAAGATCTTTCTCGAGAAAGATCTTCTCATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010917
GOLGA7B MISSION shRNA Lentiviral Transduction Particles
golgin A7 family, member B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-215s1c1
Sequence:CCGGGCTCTTTGAAGAGACTGTGAACTCGAGTTCACAGTCTCTTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-344s1c1
Sequence:CCGGCCACTATGAGAAGGTTCTCAACTCGAGTTGAGAACCTTCTCATAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010917.1-1025s1c1
Sequence:CCGGCCAGTATCTGTTCCTTCTCATCTCGAGATGAGAAGGAACAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010917.1-362s1c1
Sequence:CCGGCAAGAAGATTTCCCGCTACATCTCGAGATGTAGCGGGAAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-158s1c1
Sequence:CCGGCATCTGTCAGTTCCAGACCAACTCGAGTTGGTCTGGAACTGACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-396s1c1
Sequence:CCGGGAGAAGATCTTTGCACCTCGACTCGAGTCGAGGTGCAAAGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-339s1c1
Sequence:CCGGGAGACCCACTATGAGAAGGTTCTCGAGAACCTTCTCATAGTGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-231s1c1
Sequence:CCGGGTGAAGACCCTCAACGGATTTCTCGAGAAATCCGTTGAGGGTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-122s1c1
Sequence:CCGGCAAGGTCTTTATCCAGAGAGACTCGAGTCTCTCTGGATAAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010917.1-1352s1c1
Sequence:CCGGGCCAGTTTCCTGAGATTAGAACTCGAGTTCTAATCTCAGGAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010917.1-1817s1c1
Sequence:CCGGCCCTGTAAGTAAATGTCCAAACTCGAGTTTGGACATTTACTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010917.1-387s1c1
Sequence:CCGGGAGCAGAATGAGAAGATCTTTCTCGAGAAAGATCTTCTCATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027694
GOLGA7B MISSION shRNA Bacterial Glycerol Stock
golgin A7 family, member B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-770s1c1
Sequence:CCGGCGGAATGAGGGTTATCGAGATCTCGAGATCTCGATAACCCTCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-714s1c1
Sequence:CCGGCAGAATGAGAAGGTCTTTGCTCTCGAGAGCAAAGACCTTCTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-686s1c1
Sequence:CCGGCAAGAAGATTTCCCGTTACATCTCGAGATGTAACGGGAAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027694.1-1260s1c1
Sequence:CCGGGCATGATACTTCACCCTCAAACTCGAGTTTGAGGGTGAAGTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027694
GOLGA7B MISSION shRNA shRNA Plasmid DNA
golgin A7 family, member B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-770s1c1
Sequence:CCGGCGGAATGAGGGTTATCGAGATCTCGAGATCTCGATAACCCTCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-714s1c1
Sequence:CCGGCAGAATGAGAAGGTCTTTGCTCTCGAGAGCAAAGACCTTCTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-686s1c1
Sequence:CCGGCAAGAAGATTTCCCGTTACATCTCGAGATGTAACGGGAAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027694.1-1260s1c1
Sequence:CCGGGCATGATACTTCACCCTCAAACTCGAGTTTGAGGGTGAAGTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027694
GOLGA7B MISSION shRNA Lentiviral Transduction Particles
golgin A7 family, member B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-770s1c1
Sequence:CCGGCGGAATGAGGGTTATCGAGATCTCGAGATCTCGATAACCCTCATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-714s1c1
Sequence:CCGGCAGAATGAGAAGGTCTTTGCTCTCGAGAGCAAAGACCTTCTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027694.1-686s1c1
Sequence:CCGGCAAGAAGATTTCCCGTTACATCTCGAGATGTAACGGGAAATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027694.1-1260s1c1
Sequence:CCGGGCATGATACTTCACCCTCAAACTCGAGTTTGAGGGTGAAGTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks