EMAIL THIS PAGE TO A FRIEND

GOLGA8A

golgin A8 family, member A

211 Gene Product Result for
Synonyms: GM88
Species: Human GOLGA8A(23015)
Gene ID:
Human(23015) Summary: The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked, flattened membrane sacs referred to as cisternae. Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. The golgins constitute a family of proteins which are localized to the Golgi. This gene encodes a golgin which structurally resembles its family member GOLGA2, suggesting that they may share a similar function. There are many similar copies of this gene on chromosome 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181077 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181077 Rosetta Predictions human pricing
XM_001714558 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192815 predicted 1760
2 SASI_Hs01_00192816 predicted 1861
3 SASI_Hs01_00192817 predicted 1685
4 SASI_Hs01_00192818 predicted 1554
5 SASI_Hs02_00369931 predicted 1330
6 SASI_Hs01_00192820 predicted 1582
7 SASI_Hs02_00369932 predicted 1452
8 SASI_Hs02_00369933 predicted 1298
9 SASI_Hs01_00192822 predicted 1491
10 SASI_Hs02_00369934 predicted 2418
11 SASI_Hs01_00192819 predicted 1688
12 SASI_Hs01_00192821 predicted 1860
13 SASI_Hs01_00192823 predicted 1676
14 SASI_Hs01_00192824 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397910 predicted 1207
2 SASI_Hs02_00397911 predicted 1316
3 SASI_Hs02_00397912 predicted 1134
4 SASI_Hs02_00397913 predicted 507
5 SASI_Hs02_00397914 predicted 1011
6 SASI_Hs02_00397915 predicted 789
7 SASI_Hs02_00397916 predicted 1034
8 SASI_Hs02_00397917 predicted 907
9 SASI_Hs02_00397918 predicted 758
10 SASI_Hs02_00397919 predicted 940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015003
VALIDATED
GOLGA8A MISSION shRNA Bacterial Glycerol Stock
golgin A8 family, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-2020s1c1
Sequence:CCGGCCGACAAGCATGGTGATCTTTCTCGAGAAAGATCACCATGCTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015003.3-759s1c1
Sequence:CCGGGCAAACAATGAGAAACAGAAACTCGAGTTTCTGTTTCTCATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1114s1c1
Sequence:CCGGGAGATCAATATGCTGAACAAACTCGAGTTTGTTCAGCATATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-854s1c1
Sequence:CCGGCATGAAACATTCTCTCAGATACTCGAGTATCTGAGAGAATGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1722s1c1
Sequence:CCGGCATGTGGAGAAACTGGAACTTCTCGAGAAGTTCCAGTTTCTCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015003.3-806s1c1
Sequence:CCGGCCAGAGATTGAACACAGAGAACTCGAGTTCTCTGTGTTCAATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1181s1c1
Sequence:CCGGGCAGGAGGTTTGCACATTGAACTCGAGTTCAATGTGCAAACCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1773s1c1
Sequence:CCGGCATCAGAAAGTACATCGCCTTCTCGAGAAGGCGATGTACTTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-684s1c1
Sequence:CCGGCGACTGAATGACACCATCAAACTCGAGTTTGATGGTGTCATTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015003
VALIDATED
GOLGA8A MISSION shRNA shRNA Plasmid DNA
golgin A8 family, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-2020s1c1
Sequence:CCGGCCGACAAGCATGGTGATCTTTCTCGAGAAAGATCACCATGCTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015003.3-759s1c1
Sequence:CCGGGCAAACAATGAGAAACAGAAACTCGAGTTTCTGTTTCTCATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1114s1c1
Sequence:CCGGGAGATCAATATGCTGAACAAACTCGAGTTTGTTCAGCATATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-854s1c1
Sequence:CCGGCATGAAACATTCTCTCAGATACTCGAGTATCTGAGAGAATGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1722s1c1
Sequence:CCGGCATGTGGAGAAACTGGAACTTCTCGAGAAGTTCCAGTTTCTCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015003.3-806s1c1
Sequence:CCGGCCAGAGATTGAACACAGAGAACTCGAGTTCTCTGTGTTCAATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1181s1c1
Sequence:CCGGGCAGGAGGTTTGCACATTGAACTCGAGTTCAATGTGCAAACCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1773s1c1
Sequence:CCGGCATCAGAAAGTACATCGCCTTCTCGAGAAGGCGATGTACTTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-684s1c1
Sequence:CCGGCGACTGAATGACACCATCAAACTCGAGTTTGATGGTGTCATTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015003
VALIDATED
GOLGA8A MISSION shRNA Lentiviral Transduction Particles
golgin A8 family, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-2020s1c1
Sequence:CCGGCCGACAAGCATGGTGATCTTTCTCGAGAAAGATCACCATGCTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015003.3-759s1c1
Sequence:CCGGGCAAACAATGAGAAACAGAAACTCGAGTTTCTGTTTCTCATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1114s1c1
Sequence:CCGGGAGATCAATATGCTGAACAAACTCGAGTTTGTTCAGCATATTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-854s1c1
Sequence:CCGGCATGAAACATTCTCTCAGATACTCGAGTATCTGAGAGAATGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1722s1c1
Sequence:CCGGCATGTGGAGAAACTGGAACTTCTCGAGAAGTTCCAGTTTCTCCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015003.3-806s1c1
Sequence:CCGGCCAGAGATTGAACACAGAGAACTCGAGTTCTCTGTGTTCAATCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1181s1c1
Sequence:CCGGGCAGGAGGTTTGCACATTGAACTCGAGTTCAATGTGCAAACCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-1773s1c1
Sequence:CCGGCATCAGAAAGTACATCGCCTTCTCGAGAAGGCGATGTACTTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015003.3-684s1c1
Sequence:CCGGCGACTGAATGACACCATCAAACTCGAGTTTGATGGTGTCATTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181077
GOLGA8A MISSION shRNA Bacterial Glycerol Stock
golgin A8 family, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1561s21c1
Sequence:CCGGCAACGTTCATCGCAGCGTATACTCGAGTATACGCTGCGATGAACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181077.2-4466s21c1
Sequence:CCGGTCAATCATACATTGCCTAAATCTCGAGATTTAGGCAATGTATGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1726s21c1
Sequence:CCGGCAGTTGAAGGAGTCGCTTAAACTCGAGTTTAAGCGACTCCTTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1166s21c1
Sequence:CCGGCAGCGAAGAGGAACACGAAAGCTCGAGCTTTCGTGTTCCTCTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1661s21c1
Sequence:CCGGCACTTCTCAAGCGGCAGTTAGCTCGAGCTAACTGCCGCTTGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181077
GOLGA8A MISSION shRNA shRNA Plasmid DNA
golgin A8 family, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1561s21c1
Sequence:CCGGCAACGTTCATCGCAGCGTATACTCGAGTATACGCTGCGATGAACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181077.2-4466s21c1
Sequence:CCGGTCAATCATACATTGCCTAAATCTCGAGATTTAGGCAATGTATGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1726s21c1
Sequence:CCGGCAGTTGAAGGAGTCGCTTAAACTCGAGTTTAAGCGACTCCTTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1166s21c1
Sequence:CCGGCAGCGAAGAGGAACACGAAAGCTCGAGCTTTCGTGTTCCTCTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1661s21c1
Sequence:CCGGCACTTCTCAAGCGGCAGTTAGCTCGAGCTAACTGCCGCTTGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181077
GOLGA8A MISSION shRNA Lentiviral Transduction Particles
golgin A8 family, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1561s21c1
Sequence:CCGGCAACGTTCATCGCAGCGTATACTCGAGTATACGCTGCGATGAACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181077.2-4466s21c1
Sequence:CCGGTCAATCATACATTGCCTAAATCTCGAGATTTAGGCAATGTATGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1726s21c1
Sequence:CCGGCAGTTGAAGGAGTCGCTTAAACTCGAGTTTAAGCGACTCCTTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1166s21c1
Sequence:CCGGCAGCGAAGAGGAACACGAAAGCTCGAGCTTTCGTGTTCCTCTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181077.2-1661s21c1
Sequence:CCGGCACTTCTCAAGCGGCAGTTAGCTCGAGCTAACTGCCGCTTGAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks