EMAIL THIS PAGE TO A FRIEND

GOLGA8B

golgin A8 family, member B

Synonyms: GOLGA5
Species: Human GOLGA8B(440270)
Gene ID:
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305808 ANTI-GOLGA8B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001023567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001023567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001023567 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023567 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235416 predicted 1264
2 SASI_Hs01_00235417 predicted 1362
3 SASI_Hs01_00235418 predicted 1191
4 SASI_Hs01_00235419 predicted 1057
5 SASI_Hs01_00235421 predicted 1088
6 SASI_Hs02_00307088 predicted 1924
7 SASI_Hs01_00235423 predicted 1175
8 SASI_Hs01_00235424 predicted 1268
9 SASI_Hs01_00235425 predicted 1265
10 SASI_Hs02_00307089 predicted 1200
11 SASI_Hs01_00235420 predicted 1513
12 SASI_Hs01_00235422 predicted 1695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001023567
GOLGA8B MISSION shRNA Bacterial Glycerol Stock
golgin A8 family, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2198s1c1
Sequence:CCGGGAGCATGTGGAGAAACTGGAACTCGAGTTCCAGTTTCTCCACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023567.1-3087s1c1
Sequence:CCGGGCATGGATGTTCATTACAGAACTCGAGTTCTGTAATGAACATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2209s1c1
Sequence:CCGGGAAACTGGAACTTGGATTCATCTCGAGATGAATCCAAGTTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1592s1c1
Sequence:CCGGGAGAGAGATCAATATGCTGAACTCGAGTTCAGCATATTGATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1675s1c1
Sequence:CCGGCACATTGAAGGAGGAGAAGAACTCGAGTTCTTCTCCTCCTTCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2035s1c1
Sequence:CCGGGCAGTTGGAGCAGCAAGTAAACTCGAGTTTACTTGCTGCTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1674s1c1
Sequence:CCGGGCACATTGAAGGAGGAGAAGACTCGAGTCTTCTCCTCCTTCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001023567
GOLGA8B MISSION shRNA shRNA Plasmid DNA
golgin A8 family, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2198s1c1
Sequence:CCGGGAGCATGTGGAGAAACTGGAACTCGAGTTCCAGTTTCTCCACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023567.1-3087s1c1
Sequence:CCGGGCATGGATGTTCATTACAGAACTCGAGTTCTGTAATGAACATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2209s1c1
Sequence:CCGGGAAACTGGAACTTGGATTCATCTCGAGATGAATCCAAGTTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1592s1c1
Sequence:CCGGGAGAGAGATCAATATGCTGAACTCGAGTTCAGCATATTGATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1675s1c1
Sequence:CCGGCACATTGAAGGAGGAGAAGAACTCGAGTTCTTCTCCTCCTTCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2035s1c1
Sequence:CCGGGCAGTTGGAGCAGCAAGTAAACTCGAGTTTACTTGCTGCTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1674s1c1
Sequence:CCGGGCACATTGAAGGAGGAGAAGACTCGAGTCTTCTCCTCCTTCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001023567
GOLGA8B MISSION shRNA Lentiviral Transduction Particles
golgin A8 family, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2198s1c1
Sequence:CCGGGAGCATGTGGAGAAACTGGAACTCGAGTTCCAGTTTCTCCACATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023567.1-3087s1c1
Sequence:CCGGGCATGGATGTTCATTACAGAACTCGAGTTCTGTAATGAACATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2209s1c1
Sequence:CCGGGAAACTGGAACTTGGATTCATCTCGAGATGAATCCAAGTTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1592s1c1
Sequence:CCGGGAGAGAGATCAATATGCTGAACTCGAGTTCAGCATATTGATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1675s1c1
Sequence:CCGGCACATTGAAGGAGGAGAAGAACTCGAGTTCTTCTCCTCCTTCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-2035s1c1
Sequence:CCGGGCAGTTGGAGCAGCAAGTAAACTCGAGTTTACTTGCTGCTCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023567.1-1674s1c1
Sequence:CCGGGCACATTGAAGGAGGAGAAGACTCGAGTCTTCTCCTCCTTCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks