EMAIL THIS PAGE TO A FRIEND

GOLGA8EP

golgin A8 family, member E, pseudogene

139 Gene Product Result for
Synonyms: GOLGA8E
Species: Human GOLGA8EP(390535)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301887 ANTI-GOLGA8E (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012423 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012423 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059766 predicted 1984
2 SASI_Hs01_00059768 predicted 1835
3 SASI_Hs01_00059771 predicted 1801
4 SASI_Hs01_00059772 predicted 1839
5 SASI_Hs01_00059767 predicted 1846
6 SASI_Hs01_00059769 predicted 1183
7 SASI_Hs01_00059770 predicted 1163
8 SASI_Hs01_00059773 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012423
GOLGA8EP MISSION shRNA Bacterial Glycerol Stock
golgin A8 family, member E, pseudogene
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012423.1-1487s1c1
Sequence:CCGGGAACAGCTTCAAGGAGCTGAACTCGAGTTCAGCTCCTTGAAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012423.1-3728s1c1
Sequence:CCGGCCTCACAAACTTCTTTGTGAACTCGAGTTCACAAAGAAGTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012423.1-1050s1c1
Sequence:CCGGCAGTTGAAGGAGTCACTTAAACTCGAGTTTAAGTGACTCCTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012423.1-3387s1c1
Sequence:CCGGCCTCTGTTCATGGAGCTTCTTCTCGAGAAGAAGCTCCATGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012423.1-4492s1c1
Sequence:CCGGCCACTCTTTGTGTAGATATTTCTCGAGAAATATCTACACAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012423.1-2688s1c1
Sequence:CCGGGCCTATGTTCTGCTATTGTTTCTCGAGAAACAATAGCAGAACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012423.1-2083s1c1
Sequence:CCGGCCCACAAGCATGGTGATCTTTCTCGAGAAAGATCACCATGCTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012423
GOLGA8EP MISSION shRNA shRNA Plasmid DNA
golgin A8 family, member E, pseudogene
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012423.1-1487s1c1
Sequence:CCGGGAACAGCTTCAAGGAGCTGAACTCGAGTTCAGCTCCTTGAAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012423.1-3728s1c1
Sequence:CCGGCCTCACAAACTTCTTTGTGAACTCGAGTTCACAAAGAAGTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012423.1-1050s1c1
Sequence:CCGGCAGTTGAAGGAGTCACTTAAACTCGAGTTTAAGTGACTCCTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012423.1-3387s1c1
Sequence:CCGGCCTCTGTTCATGGAGCTTCTTCTCGAGAAGAAGCTCCATGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012423.1-4492s1c1
Sequence:CCGGCCACTCTTTGTGTAGATATTTCTCGAGAAATATCTACACAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012423.1-2688s1c1
Sequence:CCGGGCCTATGTTCTGCTATTGTTTCTCGAGAAACAATAGCAGAACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012423.1-2083s1c1
Sequence:CCGGCCCACAAGCATGGTGATCTTTCTCGAGAAAGATCACCATGCTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012423
GOLGA8EP MISSION shRNA Lentiviral Transduction Particles
golgin A8 family, member E, pseudogene
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012423.1-1487s1c1
Sequence:CCGGGAACAGCTTCAAGGAGCTGAACTCGAGTTCAGCTCCTTGAAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012423.1-3728s1c1
Sequence:CCGGCCTCACAAACTTCTTTGTGAACTCGAGTTCACAAAGAAGTTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012423.1-1050s1c1
Sequence:CCGGCAGTTGAAGGAGTCACTTAAACTCGAGTTTAAGTGACTCCTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012423.1-3387s1c1
Sequence:CCGGCCTCTGTTCATGGAGCTTCTTCTCGAGAAGAAGCTCCATGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012423.1-4492s1c1
Sequence:CCGGCCACTCTTTGTGTAGATATTTCTCGAGAAATATCTACACAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012423.1-2688s1c1
Sequence:CCGGGCCTATGTTCTGCTATTGTTTCTCGAGAAACAATAGCAGAACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012423.1-2083s1c1
Sequence:CCGGCCCACAAGCATGGTGATCTTTCTCGAGAAAGATCACCATGCTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks