EMAIL THIS PAGE TO A FRIEND

GOLGA8G

golgin A8 family, member G

150 Gene Product Result for
Species: Human GOLGA8G(283768)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302006 ANTI-GOLGA8F (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012420 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012420 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026772 predicted 1991
2 SASI_Hs01_00026774 predicted 1847
3 SASI_Hs01_00026777 predicted 1816
4 SASI_Hs01_00026778 predicted 1856
5 SASI_Hs01_00026773 predicted 1858
6 SASI_Hs01_00026775 predicted 1183
7 SASI_Hs01_00026776 predicted 1161
8 SASI_Hs01_00026779 predicted 1485
9 SASI_Hs01_00026780 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012420
GOLGA8G MISSION shRNA Bacterial Glycerol Stock
golgin A8 family, member G
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1496s1c1
Sequence:CCGGCAAGGAGCTGAACAATGAGAACTCGAGTTCTCATTGTTCAGCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1187s1c1
Sequence:CCGGGCATGATAAATATCGGGTAGACTCGAGTCTACCCGATATTTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1514s1c1
Sequence:CCGGGAACAAGAGTGTACTACAGTTCTCGAGAACTGTAGTACACTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012420.2-4424s1c1
Sequence:CCGGGCCTGTGGATTAAATCACATACTCGAGTATGTGATTTAATCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1083s1c1
Sequence:CCGGGAGAGGGATGAATATGCTGAACTCGAGTTCAGCATATTCATCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1226s1c1
Sequence:CCGGGTCCAAACTCAAACACCAGATCTCGAGATCTGGTGTTTGAGTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012420.2-2700s1c1
Sequence:CCGGGCCTATGTTCTGCTGTTGTTTCTCGAGAAACAACAGCAGAACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1527s1c1
Sequence:CCGGCTACAGTTGGAGCAGCAAGTACTCGAGTACTTGCTGCTCCAACTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1233s1c1
Sequence:CCGGCTCAAACACCAGATGGCTGAACTCGAGTTCAGCCATCTGGTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1362s1c1
Sequence:CCGGCAGCGCATAAGTCTCCTGAATCTCGAGATTCAGGAGACTTATGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1838s1c1
Sequence:CCGGCAGAGAGAGATGCCATCAGAACTCGAGTTCTGATGGCATCTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012420
GOLGA8G MISSION shRNA shRNA Plasmid DNA
golgin A8 family, member G
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1496s1c1
Sequence:CCGGCAAGGAGCTGAACAATGAGAACTCGAGTTCTCATTGTTCAGCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1187s1c1
Sequence:CCGGGCATGATAAATATCGGGTAGACTCGAGTCTACCCGATATTTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1514s1c1
Sequence:CCGGGAACAAGAGTGTACTACAGTTCTCGAGAACTGTAGTACACTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012420.2-4424s1c1
Sequence:CCGGGCCTGTGGATTAAATCACATACTCGAGTATGTGATTTAATCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1083s1c1
Sequence:CCGGGAGAGGGATGAATATGCTGAACTCGAGTTCAGCATATTCATCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1226s1c1
Sequence:CCGGGTCCAAACTCAAACACCAGATCTCGAGATCTGGTGTTTGAGTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012420.2-2700s1c1
Sequence:CCGGGCCTATGTTCTGCTGTTGTTTCTCGAGAAACAACAGCAGAACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1527s1c1
Sequence:CCGGCTACAGTTGGAGCAGCAAGTACTCGAGTACTTGCTGCTCCAACTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1233s1c1
Sequence:CCGGCTCAAACACCAGATGGCTGAACTCGAGTTCAGCCATCTGGTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1362s1c1
Sequence:CCGGCAGCGCATAAGTCTCCTGAATCTCGAGATTCAGGAGACTTATGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1838s1c1
Sequence:CCGGCAGAGAGAGATGCCATCAGAACTCGAGTTCTGATGGCATCTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012420
GOLGA8G MISSION shRNA Lentiviral Transduction Particles
golgin A8 family, member G
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1496s1c1
Sequence:CCGGCAAGGAGCTGAACAATGAGAACTCGAGTTCTCATTGTTCAGCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1187s1c1
Sequence:CCGGGCATGATAAATATCGGGTAGACTCGAGTCTACCCGATATTTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1514s1c1
Sequence:CCGGGAACAAGAGTGTACTACAGTTCTCGAGAACTGTAGTACACTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012420.2-4424s1c1
Sequence:CCGGGCCTGTGGATTAAATCACATACTCGAGTATGTGATTTAATCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1083s1c1
Sequence:CCGGGAGAGGGATGAATATGCTGAACTCGAGTTCAGCATATTCATCCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1226s1c1
Sequence:CCGGGTCCAAACTCAAACACCAGATCTCGAGATCTGGTGTTTGAGTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012420.2-2700s1c1
Sequence:CCGGGCCTATGTTCTGCTGTTGTTTCTCGAGAAACAACAGCAGAACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1527s1c1
Sequence:CCGGCTACAGTTGGAGCAGCAAGTACTCGAGTACTTGCTGCTCCAACTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1233s1c1
Sequence:CCGGCTCAAACACCAGATGGCTGAACTCGAGTTCAGCCATCTGGTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012420.2-1362s1c1
Sequence:CCGGCAGCGCATAAGTCTCCTGAATCTCGAGATTCAGGAGACTTATGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012420.2-1838s1c1
Sequence:CCGGCAGAGAGAGATGCCATCAGAACTCGAGTTCTGATGGCATCTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks