EMAIL THIS PAGE TO A FRIEND

GOLGA8I

golgin A8 family, member I

4 Gene Product Result for
Synonyms: GOLGA8IP GOLGA9P
Species: Human GOLGA8I(283796)
UniProtKB ID: A6NC78
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017720 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494180 predicted 2915
2 SASI_Hs02_00494181 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173613
GOLGA8I MISSION shRNA Bacterial Glycerol Stock
golgin A8 family, member I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-1421s1c1
Sequence:CCGGCGAGGAGCCAAACAATGAGAACTCGAGTTCTCATTGTTTGGCTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1630s1c1
Sequence:CCGGCAGTCCTGTTTCTTGCTTCCTCTCGAGAGGAAGCAAGAAACAGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-842s1c1
Sequence:CCGGGAGTGTTCTCTCTGATGTCATCTCGAGATGACATCAGAGAGAACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1079s1c1
Sequence:CCGGGCAGGAGATTTGCACATTAAACTCGAGTTTAATGTGCAAATCTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-704s1c1
Sequence:CCGGCCAGACATTGAACATACAGAACTCGAGTTCTGTATGTTCAATGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-971s1c1
Sequence:CCGGGACACAGTTGAAGGAGTCATTCTCGAGAATGACTCCTTCAACTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-809s1c1
Sequence:CCGGGCAACATTCATTGCAGCGTAACTCGAGTTACGCTGCAATGAATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1078s1c1
Sequence:CCGGCGCAGGAGATTTGCACATTAACTCGAGTTAATGTGCAAATCTCCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-1463s1c1
Sequence:CCGGGCAGCAAGTAAAGGAGCTACACTCGAGTGTAGCTCCTTTACTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173613
GOLGA8I MISSION shRNA shRNA Plasmid DNA
golgin A8 family, member I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-1421s1c1
Sequence:CCGGCGAGGAGCCAAACAATGAGAACTCGAGTTCTCATTGTTTGGCTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1630s1c1
Sequence:CCGGCAGTCCTGTTTCTTGCTTCCTCTCGAGAGGAAGCAAGAAACAGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-842s1c1
Sequence:CCGGGAGTGTTCTCTCTGATGTCATCTCGAGATGACATCAGAGAGAACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1079s1c1
Sequence:CCGGGCAGGAGATTTGCACATTAAACTCGAGTTTAATGTGCAAATCTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-704s1c1
Sequence:CCGGCCAGACATTGAACATACAGAACTCGAGTTCTGTATGTTCAATGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-971s1c1
Sequence:CCGGGACACAGTTGAAGGAGTCATTCTCGAGAATGACTCCTTCAACTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-809s1c1
Sequence:CCGGGCAACATTCATTGCAGCGTAACTCGAGTTACGCTGCAATGAATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1078s1c1
Sequence:CCGGCGCAGGAGATTTGCACATTAACTCGAGTTAATGTGCAAATCTCCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-1463s1c1
Sequence:CCGGGCAGCAAGTAAAGGAGCTACACTCGAGTGTAGCTCCTTTACTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173613
GOLGA8I MISSION shRNA Lentiviral Transduction Particles
golgin A8 family, member I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-1421s1c1
Sequence:CCGGCGAGGAGCCAAACAATGAGAACTCGAGTTCTCATTGTTTGGCTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1630s1c1
Sequence:CCGGCAGTCCTGTTTCTTGCTTCCTCTCGAGAGGAAGCAAGAAACAGGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-842s1c1
Sequence:CCGGGAGTGTTCTCTCTGATGTCATCTCGAGATGACATCAGAGAGAACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1079s1c1
Sequence:CCGGGCAGGAGATTTGCACATTAAACTCGAGTTTAATGTGCAAATCTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-704s1c1
Sequence:CCGGCCAGACATTGAACATACAGAACTCGAGTTCTGTATGTTCAATGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-971s1c1
Sequence:CCGGGACACAGTTGAAGGAGTCATTCTCGAGAATGACTCCTTCAACTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-809s1c1
Sequence:CCGGGCAACATTCATTGCAGCGTAACTCGAGTTACGCTGCAATGAATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173613.1-1078s1c1
Sequence:CCGGCGCAGGAGATTTGCACATTAACTCGAGTTAATGTGCAAATCTCCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173613.1-1463s1c1
Sequence:CCGGGCAGCAAGTAAAGGAGCTACACTCGAGTGTAGCTCCTTTACTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)