EMAIL THIS PAGE TO A FRIEND

GOLGB1

golgin B1

113 Gene Product Result for
Synonyms: GCP GCP372 GOLIM1
UniProtKB ID: Q14789, B2ZZ91, D3DN92, E7EP74, Q14398
Gene ID:
Mouse(224139) golgi autoantigen, golgin subfamily b, macrogolgin 1
Rat(192243) golgin B1
Zebrafish(566353) golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1
chicken(426868) golgin B1
cow(532923) golgin B1
Horse(100070765) golgin B1
dog(478581) golgin B1
sheep(101110468) golgin B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004487 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004487 Rosetta Predictions human pricing
NM_138885 Rosetta Predictions rat pricing
XM_001001861 Rosetta Predictions mouse pricing
XM_001481060 Rosetta Predictions mouse pricing
XM_148244 Rosetta Predictions mouse pricing
XM_901689 Rosetta Predictions mouse pricing
XM_901691 Rosetta Predictions mouse pricing
XM_901694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158604 predicted 7981
2 SASI_Hs01_00158605 predicted 8332
3 SASI_Hs02_00337722 predicted 5243
4 SASI_Hs01_00158607 predicted 1242
5 SASI_Hs01_00158608 predicted 1192
6 SASI_Hs01_00158609 predicted 9031
7 SASI_Hs02_00337723 predicted 4102
8 SASI_Hs01_00158610 predicted 5206
9 SASI_Hs01_00158611 predicted 5489
10 SASI_Hs02_00337724 predicted 4284
11 SASI_Hs01_00158606 predicted 3558
12 SASI_Hs01_00158612 predicted 1892
13 SASI_Hs01_00158613 predicted 9896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100983 predicted 8243
2 SASI_Rn01_00100984 predicted 8099
3 SASI_Rn01_00100986 predicted 8078
4 SASI_Rn01_00100988 predicted 3358
5 SASI_Rn01_00100989 predicted 5531
6 SASI_Rn01_00100990 predicted 5876
7 SASI_Rn01_00100991 predicted 4134
8 SASI_Rn01_00100992 predicted 3664
9 SASI_Rn02_00268318 predicted 5436
10 SASI_Rn02_00268319 predicted 8508
11 SASI_Rn01_00100985 predicted 2854
12 SASI_Rn01_00100987 predicted 5929
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355295 predicted 5245
2 SASI_Mm02_00355296 predicted 9836
3 SASI_Mm02_00355297 predicted 5295
4 SASI_Mm02_00355298 predicted 4237
5 SASI_Mm02_00355299 predicted 4082
6 SASI_Mm02_00355300 predicted 8344
7 SASI_Mm02_00355301 predicted 8093
8 SASI_Mm02_00355302 predicted 8682
9 SASI_Mm02_00355303 predicted 4878
10 SASI_Mm02_00355304 predicted 9320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00421723 predicted 5344
2 SASI_Mm02_00421724 predicted 9922
3 SASI_Mm02_00421725 predicted 5389
4 SASI_Mm02_00421726 predicted 4332
5 SASI_Mm02_00421727 predicted 4174
6 SASI_Mm02_00421728 predicted 8437
7 SASI_Mm02_00421729 predicted 6696
8 SASI_Mm02_00421730 predicted 8764
9 SASI_Mm02_00421731 predicted 4985
10 SASI_Mm02_00421732 predicted 9410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_148244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236693 predicted 4142
2 SASI_Mm01_00236694 predicted 8730
3 SASI_Mm01_00236695 predicted 4192
4 SASI_Mm01_00236696 predicted 3136
5 SASI_Mm01_00236697 predicted 2976
6 SASI_Mm01_00236698 predicted 7239
7 SASI_Mm01_00236699 predicted 7570
8 SASI_Mm01_00236700 predicted 3785
9 SASI_Mm01_00236701 predicted 8211
10 SASI_Mm01_00236702 predicted 6590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204626 predicted 4045
2 SASI_Mm01_00204627 predicted 8631
3 SASI_Mm01_00204628 predicted 4102
4 SASI_Mm01_00204629 predicted 3040
5 SASI_Mm01_00204630 predicted 2880
6 SASI_Mm01_00204631 predicted 7136
7 SASI_Mm01_00204632 predicted 7468
8 SASI_Mm01_00204633 predicted 3690
9 SASI_Mm01_00204634 predicted 8110
10 SASI_Mm01_00204635 predicted 6484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233392 predicted 337
2 SASI_Mm01_00233393 predicted 345
3 SASI_Mm01_00233394 predicted 569
4 SASI_Mm01_00233395 predicted 292
5 SASI_Mm01_00233396 predicted 340
6 SASI_Mm01_00233397 predicted 714
7 SASI_Mm01_00233398 predicted 547
8 SASI_Mm01_00233399 predicted 345
9 SASI_Mm01_00233400 predicted 419
10 SASI_Mm01_00233401 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206650 predicted 3952
2 SASI_Mm01_00206651 predicted 8533
3 SASI_Mm01_00206652 predicted 3993
4 SASI_Mm01_00206653 predicted 2935
5 SASI_Mm01_00206654 predicted 2781
6 SASI_Mm01_00206655 predicted 7036
7 SASI_Mm01_00206656 predicted 7372
8 SASI_Mm01_00206657 predicted 3588
9 SASI_Mm01_00206658 predicted 8015
10 SASI_Mm01_00206659 predicted 6392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004487
VALIDATED
GOLGB1 MISSION shRNA Bacterial Glycerol Stock
golgin B1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004487.1-9992s1c1
Sequence:CCGGGTCTTCCCATTTACAGGTCTTCTCGAGAAGACCTGTAAATGGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004487.1-8197s1c1
Sequence:CCGGGCAGGGATAATGAGAAATGAACTCGAGTTCATTTCTCATTATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-8588s1c1
Sequence:CCGGCCTCACAACTAGAAGATTCTTCTCGAGAAGAATCTTCTAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004487.1-10123s1c1
Sequence:CCGGGCTTCTGCTTAATCTGAGAATCTCGAGATTCTCAGATTAAGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004487.1-3536s1c1
Sequence:CCGGCCGTAGCACTTGTAAAGGAAACTCGAGTTTCCTTTACAAGTGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-3031s1c1
Sequence:CCGGGCAGGACAAATAAGTAAGGAACTCGAGTTCCTTACTTATTTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-7996s1c1
Sequence:CCGGGAAGGTACTTTAGGACTCTATCTCGAGATAGAGTCCTAAAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004487.1-6412s1c1
Sequence:CCGGGCAGACAATCTCAAGTTGAAACTCGAGTTTCAACTTGAGATTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004487.1-2048s1c1
Sequence:CCGGGCACTGAACATCAAAGTAGAACTCGAGTTCTACTTTGATGTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004487
VALIDATED
GOLGB1 MISSION shRNA shRNA Plasmid DNA
golgin B1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004487.1-9992s1c1
Sequence:CCGGGTCTTCCCATTTACAGGTCTTCTCGAGAAGACCTGTAAATGGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004487.1-8197s1c1
Sequence:CCGGGCAGGGATAATGAGAAATGAACTCGAGTTCATTTCTCATTATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-8588s1c1
Sequence:CCGGCCTCACAACTAGAAGATTCTTCTCGAGAAGAATCTTCTAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004487.1-10123s1c1
Sequence:CCGGGCTTCTGCTTAATCTGAGAATCTCGAGATTCTCAGATTAAGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004487.1-3536s1c1
Sequence:CCGGCCGTAGCACTTGTAAAGGAAACTCGAGTTTCCTTTACAAGTGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-3031s1c1
Sequence:CCGGGCAGGACAAATAAGTAAGGAACTCGAGTTCCTTACTTATTTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-7996s1c1
Sequence:CCGGGAAGGTACTTTAGGACTCTATCTCGAGATAGAGTCCTAAAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004487.1-6412s1c1
Sequence:CCGGGCAGACAATCTCAAGTTGAAACTCGAGTTTCAACTTGAGATTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004487.1-2048s1c1
Sequence:CCGGGCACTGAACATCAAAGTAGAACTCGAGTTCTACTTTGATGTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004487
VALIDATED
GOLGB1 MISSION shRNA Lentiviral Transduction Particles
golgin B1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004487.1-9992s1c1
Sequence:CCGGGTCTTCCCATTTACAGGTCTTCTCGAGAAGACCTGTAAATGGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004487.1-8197s1c1
Sequence:CCGGGCAGGGATAATGAGAAATGAACTCGAGTTCATTTCTCATTATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-8588s1c1
Sequence:CCGGCCTCACAACTAGAAGATTCTTCTCGAGAAGAATCTTCTAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004487.1-10123s1c1
Sequence:CCGGGCTTCTGCTTAATCTGAGAATCTCGAGATTCTCAGATTAAGCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004487.1-3536s1c1
Sequence:CCGGCCGTAGCACTTGTAAAGGAAACTCGAGTTTCCTTTACAAGTGCTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-3031s1c1
Sequence:CCGGGCAGGACAAATAAGTAAGGAACTCGAGTTCCTTACTTATTTGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004487.1-7996s1c1
Sequence:CCGGGAAGGTACTTTAGGACTCTATCTCGAGATAGAGTCCTAAAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004487.1-6412s1c1
Sequence:CCGGGCAGACAATCTCAAGTTGAAACTCGAGTTTCAACTTGAGATTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004487.1-2048s1c1
Sequence:CCGGGCACTGAACATCAAAGTAGAACTCGAGTTCTACTTTGATGTTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030035
VALIDATED
GOLGB1 MISSION shRNA Bacterial Glycerol Stock
golgin B1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030035.1-7764s21c1
Sequence:CCGGGAACGAGGTGATAGCCATAAACTCGAGTTTATGGCTATCACCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-9878s21c1
Sequence:CCGGGTTTCACGGGTCACCTATAAACTCGAGTTTATAGGTGACCCGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-9912s21c1
Sequence:CCGGTGCAACTCTGGAACTTGTAATCTCGAGATTACAAGTTCCAGAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-289s21c1
Sequence:CCGGACTGCCATGGAATCGAATAATCTCGAGATTATTCGATTCCATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030035
VALIDATED
GOLGB1 MISSION shRNA shRNA Plasmid DNA
golgin B1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030035.1-7764s21c1
Sequence:CCGGGAACGAGGTGATAGCCATAAACTCGAGTTTATGGCTATCACCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-9878s21c1
Sequence:CCGGGTTTCACGGGTCACCTATAAACTCGAGTTTATAGGTGACCCGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-9912s21c1
Sequence:CCGGTGCAACTCTGGAACTTGTAATCTCGAGATTACAAGTTCCAGAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-289s21c1
Sequence:CCGGACTGCCATGGAATCGAATAATCTCGAGATTATTCGATTCCATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030035
VALIDATED
GOLGB1 MISSION shRNA Lentiviral Transduction Particles
golgin B1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030035.1-7764s21c1
Sequence:CCGGGAACGAGGTGATAGCCATAAACTCGAGTTTATGGCTATCACCTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-9878s21c1
Sequence:CCGGGTTTCACGGGTCACCTATAAACTCGAGTTTATAGGTGACCCGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-9912s21c1
Sequence:CCGGTGCAACTCTGGAACTTGTAATCTCGAGATTACAAGTTCCAGAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030035.1-289s21c1
Sequence:CCGGACTGCCATGGAATCGAATAATCTCGAGATTATTCGATTCCATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks