EMAIL THIS PAGE TO A FRIEND

GOLIM4

golgi integral membrane protein 4

119 Gene Product Result for
Synonyms: GIMPC GOLPH4 GPP130 P138
UniProtKB ID: O00461
Gene ID:
Human(27333) Summary: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi-resident protein. It may process proteins synthesized in the rough endoplasmic reticulum and assist in the transport of protein cargo through the Golgi apparatus. [provided by RefSeq, Jul 2008]
Mouse(73124) golgi integral membrane protein 4
Rat(310526) golgi integral membrane protein 4
chicken(425000) golgi integral membrane protein 4
dog(478685) golgi integral membrane protein 4
Horse(100062569) golgi integral membrane protein 4
cow(538532) golgi integral membrane protein 4
domestic cat(101090133) golgi integral membrane protein 4
sheep(101122321) golgi integral membrane protein 4
domestic guinea pig(100734777) golgi integral membrane protein 4
naked mole-rat(101716863) golgi integral membrane protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014498 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014498 Rosetta Predictions human pricing
XM_001062460 Rosetta Predictions rat pricing
XM_001062524 Rosetta Predictions rat pricing
XM_001070329 Rosetta Predictions rat pricing
XM_227268 Rosetta Predictions rat pricing
NM_175193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345751 predicted 1315
2 SASI_Hs01_00148816 predicted 857
3 SASI_Hs01_00148817 predicted 785
4 SASI_Hs01_00148818 predicted 853
5 SASI_Hs01_00148819 predicted 519
6 SASI_Hs02_00345752 predicted 676
7 SASI_Hs01_00148820 predicted 1046
8 SASI_Hs01_00148821 predicted 913
9 SASI_Hs01_00148822 predicted 2437
10 SASI_Hs01_00148824 predicted 719
11 SASI_Hs01_00148815 predicted 1234
12 SASI_Hs01_00148823 predicted 2664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303507 predicted 1126
2 SASI_Rn02_00303508 predicted 952
3 SASI_Rn02_00303509 predicted 303
4 SASI_Rn02_00303510 predicted 563
5 SASI_Rn02_00303511 predicted 1176
6 SASI_Rn02_00303512 predicted 335
7 SASI_Rn02_00303513 predicted 289
8 SASI_Rn02_00303514 predicted 969
9 SASI_Rn02_00303515 predicted 457
10 SASI_Rn02_00303516 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303742 predicted 2239
2 SASI_Rn02_00303743 predicted 2105
3 SASI_Rn02_00303744 predicted 2749
4 SASI_Rn02_00303745 predicted 2172
5 SASI_Rn02_00303746 predicted 2331
6 SASI_Rn02_00303747 predicted 2112
7 SASI_Rn02_00303748 predicted 1788
8 SASI_Rn02_00303749 predicted 1896
9 SASI_Rn02_00303750 predicted 3365
10 SASI_Rn02_00303751 predicted 1785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331258 predicted 1131
2 SASI_Rn02_00331259 predicted 950
3 SASI_Rn02_00331260 predicted 297
4 SASI_Rn02_00331261 predicted 567
5 SASI_Rn02_00331262 predicted 1173
6 SASI_Rn02_00331263 predicted 336
7 SASI_Rn02_00331264 predicted 286
8 SASI_Rn02_00331265 predicted 967
9 SASI_Rn02_00331266 predicted 462
10 SASI_Rn02_00331267 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384197 predicted 2242
2 SASI_Rn02_00384198 predicted 2110
3 SASI_Rn02_00384199 predicted 2756
4 SASI_Rn02_00384200 predicted 2174
5 SASI_Rn02_00384201 predicted 2333
6 SASI_Rn02_00384202 predicted 2113
7 SASI_Rn02_00384203 predicted 1790
8 SASI_Rn02_00384204 predicted 1897
9 SASI_Rn02_00384205 predicted 3367
10 SASI_Rn02_00384206 predicted 1781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026737 predicted 2010
2 SASI_Mm01_00026738 predicted 962
3 SASI_Mm01_00026739 predicted 1111
4 SASI_Mm01_00026740 predicted 2332
5 SASI_Mm01_00026741 predicted 2565
6 SASI_Mm01_00026742 predicted 1040
7 SASI_Mm01_00026743 predicted 2320
8 SASI_Mm01_00026744 predicted 711
9 SASI_Mm01_00026745 predicted 2579
10 SASI_Mm01_00026746 predicted 965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014498
VALIDATED
GOLIM4 MISSION shRNA Bacterial Glycerol Stock
golgi integral membrane protein 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014498.3-1254s21c1
Sequence:CCGGCTCTATGCTCCCACCCATAAGCTCGAGCTTATGGGTGGGAGCATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014498.3-544s21c1
Sequence:CCGGACAGATCAAGATTAGAGAAATCTCGAGATTTCTCTAATCTTGATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014498.3-2575s21c1
Sequence:CCGGGCGCATACATTTATATGAATACTCGAGTATTCATATAAATGTATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2737s1c1
Sequence:CCGGGCTCAAACATAAATCTGCCTACTCGAGTAGGCAGATTTATGTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2232s1c1
Sequence:CCGGGAAGATATAAACCCAGCAGATCTCGAGATCTGCTGGGTTTATATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-1278s1c1
Sequence:CCGGCAGACTCAAGTTGCAGAATATCTCGAGATATTCTGCAACTTGAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2649s1c1
Sequence:CCGGGCAGTTGCTGAGAAATCACATCTCGAGATGTGATTTCTCAGCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014498.2-1563s1c1
Sequence:CCGGCAAGAAGTGGAACGCAGAGAACTCGAGTTCTCTGCGTTCCACTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014498.2-3128s1c1
Sequence:CCGGGCTGCCCTTCTGATGTCTTTACTCGAGTAAAGACATCAGAAGGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2142s1c1
Sequence:CCGGGCAGAAGGAGATCCAGGTAATCTCGAGATTACCTGGATCTCCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014498.2-1656s1c1
Sequence:CCGGGCAGAACATCTTGAGGAGGAACTCGAGTTCCTCCTCAAGATGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014498
VALIDATED
GOLIM4 MISSION shRNA shRNA Plasmid DNA
golgi integral membrane protein 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014498.3-1254s21c1
Sequence:CCGGCTCTATGCTCCCACCCATAAGCTCGAGCTTATGGGTGGGAGCATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014498.3-544s21c1
Sequence:CCGGACAGATCAAGATTAGAGAAATCTCGAGATTTCTCTAATCTTGATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014498.3-2575s21c1
Sequence:CCGGGCGCATACATTTATATGAATACTCGAGTATTCATATAAATGTATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2737s1c1
Sequence:CCGGGCTCAAACATAAATCTGCCTACTCGAGTAGGCAGATTTATGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2232s1c1
Sequence:CCGGGAAGATATAAACCCAGCAGATCTCGAGATCTGCTGGGTTTATATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-1278s1c1
Sequence:CCGGCAGACTCAAGTTGCAGAATATCTCGAGATATTCTGCAACTTGAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2649s1c1
Sequence:CCGGGCAGTTGCTGAGAAATCACATCTCGAGATGTGATTTCTCAGCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014498.2-1563s1c1
Sequence:CCGGCAAGAAGTGGAACGCAGAGAACTCGAGTTCTCTGCGTTCCACTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014498.2-3128s1c1
Sequence:CCGGGCTGCCCTTCTGATGTCTTTACTCGAGTAAAGACATCAGAAGGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2142s1c1
Sequence:CCGGGCAGAAGGAGATCCAGGTAATCTCGAGATTACCTGGATCTCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014498.2-1656s1c1
Sequence:CCGGGCAGAACATCTTGAGGAGGAACTCGAGTTCCTCCTCAAGATGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014498
VALIDATED
GOLIM4 MISSION shRNA Lentiviral Transduction Particles
golgi integral membrane protein 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014498.3-1254s21c1
Sequence:CCGGCTCTATGCTCCCACCCATAAGCTCGAGCTTATGGGTGGGAGCATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014498.3-544s21c1
Sequence:CCGGACAGATCAAGATTAGAGAAATCTCGAGATTTCTCTAATCTTGATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014498.3-2575s21c1
Sequence:CCGGGCGCATACATTTATATGAATACTCGAGTATTCATATAAATGTATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2737s1c1
Sequence:CCGGGCTCAAACATAAATCTGCCTACTCGAGTAGGCAGATTTATGTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2232s1c1
Sequence:CCGGGAAGATATAAACCCAGCAGATCTCGAGATCTGCTGGGTTTATATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-1278s1c1
Sequence:CCGGCAGACTCAAGTTGCAGAATATCTCGAGATATTCTGCAACTTGAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2649s1c1
Sequence:CCGGGCAGTTGCTGAGAAATCACATCTCGAGATGTGATTTCTCAGCAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014498.2-1563s1c1
Sequence:CCGGCAAGAAGTGGAACGCAGAGAACTCGAGTTCTCTGCGTTCCACTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014498.2-3128s1c1
Sequence:CCGGGCTGCCCTTCTGATGTCTTTACTCGAGTAAAGACATCAGAAGGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014498.2-2142s1c1
Sequence:CCGGGCAGAAGGAGATCCAGGTAATCTCGAGATTACCTGGATCTCCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014498.2-1656s1c1
Sequence:CCGGGCAGAACATCTTGAGGAGGAACTCGAGTTCCTCCTCAAGATGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175193
VALIDATED
GOLIM4 MISSION shRNA Bacterial Glycerol Stock
golgi integral membrane protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-845s21c1
Sequence:CCGGGCAAGATTCCAATAGCAGATACTCGAGTATCTGCTATTGGAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-708s21c1
Sequence:CCGGGCCCAGTTGCAAGTTGTATATCTCGAGATATACAACTTGCAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175193.5-3609s21c1
Sequence:CCGGCCCTGAAATGAGCACATATTTCTCGAGAAATATGTGCTCATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-2082s21c1
Sequence:CCGGCCCAACAATCAAGGCGAAGATCTCGAGATCTTCGCCTTGATTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-2313s21c1
Sequence:CCGGCGGGAAATGGAGCATAATGTTCTCGAGAACATTATGCTCCATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-3609s1c1
Sequence:CCGGCCCTGAAATGAGCACATATTTCTCGAGAAATATGTGCTCATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175193.4-845s1c1
Sequence:CCGGGCAAGATTCCAATAGCAGATACTCGAGTATCTGCTATTGGAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-708s1c1
Sequence:CCGGGCCCAGTTGCAAGTTGTATATCTCGAGATATACAACTTGCAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-2313s1c1
Sequence:CCGGCGGGAAATGGAGCATAATGTTCTCGAGAACATTATGCTCCATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-2082s1c1
Sequence:CCGGCCCAACAATCAAGGCGAAGATCTCGAGATCTTCGCCTTGATTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175193
VALIDATED
GOLIM4 MISSION shRNA shRNA Plasmid DNA
golgi integral membrane protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-845s21c1
Sequence:CCGGGCAAGATTCCAATAGCAGATACTCGAGTATCTGCTATTGGAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-708s21c1
Sequence:CCGGGCCCAGTTGCAAGTTGTATATCTCGAGATATACAACTTGCAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175193.5-3609s21c1
Sequence:CCGGCCCTGAAATGAGCACATATTTCTCGAGAAATATGTGCTCATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-2082s21c1
Sequence:CCGGCCCAACAATCAAGGCGAAGATCTCGAGATCTTCGCCTTGATTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-2313s21c1
Sequence:CCGGCGGGAAATGGAGCATAATGTTCTCGAGAACATTATGCTCCATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-3609s1c1
Sequence:CCGGCCCTGAAATGAGCACATATTTCTCGAGAAATATGTGCTCATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175193.4-845s1c1
Sequence:CCGGGCAAGATTCCAATAGCAGATACTCGAGTATCTGCTATTGGAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-708s1c1
Sequence:CCGGGCCCAGTTGCAAGTTGTATATCTCGAGATATACAACTTGCAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-2313s1c1
Sequence:CCGGCGGGAAATGGAGCATAATGTTCTCGAGAACATTATGCTCCATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-2082s1c1
Sequence:CCGGCCCAACAATCAAGGCGAAGATCTCGAGATCTTCGCCTTGATTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175193
VALIDATED
GOLIM4 MISSION shRNA Lentiviral Transduction Particles
golgi integral membrane protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-845s21c1
Sequence:CCGGGCAAGATTCCAATAGCAGATACTCGAGTATCTGCTATTGGAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-708s21c1
Sequence:CCGGGCCCAGTTGCAAGTTGTATATCTCGAGATATACAACTTGCAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175193.5-3609s21c1
Sequence:CCGGCCCTGAAATGAGCACATATTTCTCGAGAAATATGTGCTCATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-2082s21c1
Sequence:CCGGCCCAACAATCAAGGCGAAGATCTCGAGATCTTCGCCTTGATTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175193.5-2313s21c1
Sequence:CCGGCGGGAAATGGAGCATAATGTTCTCGAGAACATTATGCTCCATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-3609s1c1
Sequence:CCGGCCCTGAAATGAGCACATATTTCTCGAGAAATATGTGCTCATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175193.4-845s1c1
Sequence:CCGGGCAAGATTCCAATAGCAGATACTCGAGTATCTGCTATTGGAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-708s1c1
Sequence:CCGGGCCCAGTTGCAAGTTGTATATCTCGAGATATACAACTTGCAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-2313s1c1
Sequence:CCGGCGGGAAATGGAGCATAATGTTCTCGAGAACATTATGCTCCATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175193.4-2082s1c1
Sequence:CCGGCCCAACAATCAAGGCGAAGATCTCGAGATCTTCGCCTTGATTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)