EMAIL THIS PAGE TO A FRIEND

GOLM1

golgi membrane protein 1

86 Gene Product Result for
Synonyms: C9orf155 GOLPH2 GP73 PSEC0257 bA379P1.3
UniProtKB ID: Q8NBJ4, Q6IAF4, Q9NRB9
Gene ID:
Human(51280) Summary: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
Mouse(105348) golgi membrane protein 1
Rat(680692) golgi membrane protein 1
chicken(427462) golgi membrane protein 1
dog(476303) golgi membrane protein 1
cow(517052) golgi membrane protein 1
domestic cat(101083552) golgi membrane protein 1
domestic guinea pig(100722838) golgi membrane protein 1
naked mole-rat(101723316) golgi membrane protein 1
sheep(101115000) golgi membrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016548 Rosetta Predictions human pricing
NM_177937 Rosetta Predictions human pricing
XM_001056825 Rosetta Predictions rat pricing
XM_001056896 Rosetta Predictions rat pricing
NM_001035122 Rosetta Predictions mouse pricing
NM_027307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223155 predicted 1354
2 SASI_Hs01_00223156 predicted 1664
3 SASI_Hs01_00223157 predicted 1393
4 SASI_Hs01_00223158 predicted 714
5 SASI_Hs01_00223159 predicted 1388
6 SASI_Hs01_00223160 predicted 1503
7 SASI_Hs01_00223161 predicted 1621
8 SASI_Hs01_00223162 predicted 1228
9 SASI_Hs02_00349669 predicted 556
10 SASI_Hs01_00223163 predicted 1354
11 SASI_Hs01_00223164 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174119 predicted 1317
2 SASI_Hs01_00174120 predicted 1626
3 SASI_Hs01_00174121 predicted 1369
4 SASI_Hs01_00174122 predicted 677
5 SASI_Hs01_00174123 predicted 1347
6 SASI_Hs01_00174124 predicted 1471
7 SASI_Hs01_00174125 predicted 1596
8 SASI_Hs01_00174126 predicted 1200
9 SASI_Hs02_00369421 predicted 531
10 SASI_Hs01_00174127 predicted 1314
11 SASI_Hs01_00174128 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284560 predicted 1060
2 SASI_Rn02_00284561 predicted 827
3 SASI_Rn02_00284562 predicted 1067
4 SASI_Rn02_00284563 predicted 1087
5 SASI_Rn02_00284564 predicted 1217
6 SASI_Rn02_00284565 predicted 465
7 SASI_Rn02_00284566 predicted 1202
8 SASI_Rn02_00284567 predicted 1139
9 SASI_Rn02_00284568 predicted 615
10 SASI_Rn02_00284569 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284790 predicted 1339
2 SASI_Rn02_00284791 predicted 540
3 SASI_Rn02_00284792 predicted 832
4 SASI_Rn02_00284793 predicted 842
5 SASI_Rn02_00284794 predicted 1357
6 SASI_Rn02_00284795 predicted 1488
7 SASI_Rn02_00284796 predicted 469
8 SASI_Rn02_00284797 predicted 1466
9 SASI_Rn02_00284798 predicted 1416
10 SASI_Rn02_00284799 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045712 predicted 1662
2 SASI_Mm01_00045713 predicted 1628
3 SASI_Mm01_00045714 predicted 592
4 SASI_Mm01_00045715 predicted 1122
5 SASI_Mm02_00289238 predicted 720
6 SASI_Mm01_00045716 predicted 908
7 SASI_Mm01_00045717 predicted 436
8 SASI_Mm01_00045718 predicted 1742
9 SASI_Mm01_00045719 predicted 1755
10 SASI_Mm01_00045720 predicted 1591
11 SASI_Mm01_00045721 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057834 predicted 1794
2 SASI_Mm01_00057835 predicted 1773
3 SASI_Mm01_00057836 predicted 725
4 SASI_Mm01_00057837 predicted 1265
5 SASI_Mm02_00331918 predicted 853
6 SASI_Mm01_00057838 predicted 1044
7 SASI_Mm01_00057839 predicted 575
8 SASI_Mm01_00057840 predicted 1881
9 SASI_Mm01_00057841 predicted 1888
10 SASI_Mm01_00057842 predicted 1725
11 SASI_Mm01_00057843 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016548
VALIDATED
GOLM1 MISSION shRNA Bacterial Glycerol Stock
golgi membrane protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-517s1c1
Sequence:CCGGGTGAATAACATCACCACAGGTCTCGAGACCTGTGGTGATGTTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-1303s1c1
Sequence:CCGGGCAGGGAATGACAGAAACATACTCGAGTATGTTTCTGTCATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016548.2-700s1c1
Sequence:CCGGGAACAGTGTGAGGAGCGAATACTCGAGTATTCGCTCCTCACACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-270s1c1
Sequence:CCGGCATCATCGTCTTGGGCTTCAACTCGAGTTGAAGCCCAAGACGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-666s1c1
Sequence:CCGGGAGCCAGTGCATCAATCAGATCTCGAGATCTGATTGATGCACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-551s1c1
Sequence:CCGGGAGTGCTGCAAGACCAGTTAACTCGAGTTAACTGGTCTTGCAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016548.2-2628s1c1
Sequence:CCGGCCACAGGATTTGAGATGCTAACTCGAGTTAGCATCTCAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016548.2-1644s1c1
Sequence:CCGGCGTGAGAAGTTCAACACCAAACTCGAGTTTGGTGTTGAACTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-867s1c1
Sequence:CCGGGAAGGGAAACGTGCTTGGTAACTCGAGTTACCAAGCACGTTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016548.2-715s1c1
Sequence:CCGGCGAATAGAAGAGGTCACCAAACTCGAGTTTGGTGACCTCTTCTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-1243s1c1
Sequence:CCGGGATGACTACAACATGGATGAACTCGAGTTCATCCATGTTGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-1240s1c1
Sequence:CCGGGAAGATGACTACAACATGGATCTCGAGATCCATGTTGTAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016548.2-2274s1c1
Sequence:CCGGGCCTACTTTATTACTGGAGTACTCGAGTACTCCAGTAATAAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016548.2-946s1c1
Sequence:CCGGGTTGAGAAAGAGGAAACCAATCTCGAGATTGGTTTCCTCTTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016548
VALIDATED
GOLM1 MISSION shRNA shRNA Plasmid DNA
golgi membrane protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-517s1c1
Sequence:CCGGGTGAATAACATCACCACAGGTCTCGAGACCTGTGGTGATGTTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-1303s1c1
Sequence:CCGGGCAGGGAATGACAGAAACATACTCGAGTATGTTTCTGTCATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016548.2-700s1c1
Sequence:CCGGGAACAGTGTGAGGAGCGAATACTCGAGTATTCGCTCCTCACACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-270s1c1
Sequence:CCGGCATCATCGTCTTGGGCTTCAACTCGAGTTGAAGCCCAAGACGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-666s1c1
Sequence:CCGGGAGCCAGTGCATCAATCAGATCTCGAGATCTGATTGATGCACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-551s1c1
Sequence:CCGGGAGTGCTGCAAGACCAGTTAACTCGAGTTAACTGGTCTTGCAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016548.2-2628s1c1
Sequence:CCGGCCACAGGATTTGAGATGCTAACTCGAGTTAGCATCTCAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016548.2-1644s1c1
Sequence:CCGGCGTGAGAAGTTCAACACCAAACTCGAGTTTGGTGTTGAACTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-867s1c1
Sequence:CCGGGAAGGGAAACGTGCTTGGTAACTCGAGTTACCAAGCACGTTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016548.2-715s1c1
Sequence:CCGGCGAATAGAAGAGGTCACCAAACTCGAGTTTGGTGACCTCTTCTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-1243s1c1
Sequence:CCGGGATGACTACAACATGGATGAACTCGAGTTCATCCATGTTGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-1240s1c1
Sequence:CCGGGAAGATGACTACAACATGGATCTCGAGATCCATGTTGTAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016548.2-2274s1c1
Sequence:CCGGGCCTACTTTATTACTGGAGTACTCGAGTACTCCAGTAATAAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016548.2-946s1c1
Sequence:CCGGGTTGAGAAAGAGGAAACCAATCTCGAGATTGGTTTCCTCTTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016548
VALIDATED
GOLM1 MISSION shRNA Lentiviral Transduction Particles
golgi membrane protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-517s1c1
Sequence:CCGGGTGAATAACATCACCACAGGTCTCGAGACCTGTGGTGATGTTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-1303s1c1
Sequence:CCGGGCAGGGAATGACAGAAACATACTCGAGTATGTTTCTGTCATTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016548.2-700s1c1
Sequence:CCGGGAACAGTGTGAGGAGCGAATACTCGAGTATTCGCTCCTCACACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-270s1c1
Sequence:CCGGCATCATCGTCTTGGGCTTCAACTCGAGTTGAAGCCCAAGACGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-666s1c1
Sequence:CCGGGAGCCAGTGCATCAATCAGATCTCGAGATCTGATTGATGCACTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-551s1c1
Sequence:CCGGGAGTGCTGCAAGACCAGTTAACTCGAGTTAACTGGTCTTGCAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016548.2-2628s1c1
Sequence:CCGGCCACAGGATTTGAGATGCTAACTCGAGTTAGCATCTCAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016548.2-1644s1c1
Sequence:CCGGCGTGAGAAGTTCAACACCAAACTCGAGTTTGGTGTTGAACTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-867s1c1
Sequence:CCGGGAAGGGAAACGTGCTTGGTAACTCGAGTTACCAAGCACGTTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016548.2-715s1c1
Sequence:CCGGCGAATAGAAGAGGTCACCAAACTCGAGTTTGGTGACCTCTTCTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016548.2-1243s1c1
Sequence:CCGGGATGACTACAACATGGATGAACTCGAGTTCATCCATGTTGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016548.2-1240s1c1
Sequence:CCGGGAAGATGACTACAACATGGATCTCGAGATCCATGTTGTAGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016548.2-2274s1c1
Sequence:CCGGGCCTACTTTATTACTGGAGTACTCGAGTACTCCAGTAATAAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016548.2-946s1c1
Sequence:CCGGGTTGAGAAAGAGGAAACCAATCTCGAGATTGGTTTCCTCTTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027307
VALIDATED
GOLM1 MISSION shRNA Bacterial Glycerol Stock
golgi membrane protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-296s1c1
Sequence:CCGGGCTAGGCTTCAACTACTGGATCTCGAGATCCAGTAGTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-786s1c1
Sequence:CCGGGCTGAAACCAACAACCAACATCTCGAGATGTTGGTTGTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-617s1c1
Sequence:CCGGGCAGCAGGATATCTTCCAATTCTCGAGAATTGGAAGATATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-1263s1c1
Sequence:CCGGGCAGGGAATGACAGAAATATACTCGAGTATATTTCTGTCATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-3488s1c1
Sequence:CCGGGCCTACAAACTCCTACCTGATCTCGAGATCAGGTAGGAGTTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-296s21c1
Sequence:CCGGGCTAGGCTTCAACTACTGGATCTCGAGATCCAGTAGTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-1263s21c1
Sequence:CCGGGCAGGGAATGACAGAAATATACTCGAGTATATTTCTGTCATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-786s21c1
Sequence:CCGGGCTGAAACCAACAACCAACATCTCGAGATGTTGGTTGTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-617s21c1
Sequence:CCGGGCAGCAGGATATCTTCCAATTCTCGAGAATTGGAAGATATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027307
VALIDATED
GOLM1 MISSION shRNA shRNA Plasmid DNA
golgi membrane protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-296s1c1
Sequence:CCGGGCTAGGCTTCAACTACTGGATCTCGAGATCCAGTAGTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-786s1c1
Sequence:CCGGGCTGAAACCAACAACCAACATCTCGAGATGTTGGTTGTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-617s1c1
Sequence:CCGGGCAGCAGGATATCTTCCAATTCTCGAGAATTGGAAGATATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-1263s1c1
Sequence:CCGGGCAGGGAATGACAGAAATATACTCGAGTATATTTCTGTCATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-3488s1c1
Sequence:CCGGGCCTACAAACTCCTACCTGATCTCGAGATCAGGTAGGAGTTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-296s21c1
Sequence:CCGGGCTAGGCTTCAACTACTGGATCTCGAGATCCAGTAGTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-1263s21c1
Sequence:CCGGGCAGGGAATGACAGAAATATACTCGAGTATATTTCTGTCATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-786s21c1
Sequence:CCGGGCTGAAACCAACAACCAACATCTCGAGATGTTGGTTGTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-617s21c1
Sequence:CCGGGCAGCAGGATATCTTCCAATTCTCGAGAATTGGAAGATATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027307
VALIDATED
GOLM1 MISSION shRNA Lentiviral Transduction Particles
golgi membrane protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-296s1c1
Sequence:CCGGGCTAGGCTTCAACTACTGGATCTCGAGATCCAGTAGTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-786s1c1
Sequence:CCGGGCTGAAACCAACAACCAACATCTCGAGATGTTGGTTGTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-617s1c1
Sequence:CCGGGCAGCAGGATATCTTCCAATTCTCGAGAATTGGAAGATATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-1263s1c1
Sequence:CCGGGCAGGGAATGACAGAAATATACTCGAGTATATTTCTGTCATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027307.3-3488s1c1
Sequence:CCGGGCCTACAAACTCCTACCTGATCTCGAGATCAGGTAGGAGTTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-296s21c1
Sequence:CCGGGCTAGGCTTCAACTACTGGATCTCGAGATCCAGTAGTTGAAGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-1263s21c1
Sequence:CCGGGCAGGGAATGACAGAAATATACTCGAGTATATTTCTGTCATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-786s21c1
Sequence:CCGGGCTGAAACCAACAACCAACATCTCGAGATGTTGGTTGTTGGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027307.4-617s21c1
Sequence:CCGGGCAGCAGGATATCTTCCAATTCTCGAGAATTGGAAGATATCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks