EMAIL THIS PAGE TO A FRIEND

GOLPH3

golgi phosphoprotein 3 (coat-protein)

Synonyms: GOPP1 GPP34 MIDAS
UniProtKB ID: Q9H4A6, Q9UIW5
Gene ID:
Human(64083) Summary: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a peripheral membrane protein of the Golgi stack and may have a regulatory role in Golgi trafficking. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(66629) golgi phosphoprotein 3
Rat(78961) golgi phosphoprotein 3 (coat-protein)
sheep(101115313) golgi phosphoprotein 3 (coat-protein)
domestic guinea pig(100717371) golgi phosphoprotein 3 (coat-protein)
naked mole-rat(101724890) golgi phosphoprotein 3 (coat-protein)
Zebrafish(450085) golgi phosphoprotein 3
chicken(427422) golgi phosphoprotein 3 (coat-protein)
dog(489241) golgi phosphoprotein 3 (coat-protein)
cow(531359) golgi phosphoprotein 3 (coat-protein)
domestic cat(101081446) golgi phosphoprotein 3 (coat-protein)
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022130 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022130 Rosetta Predictions human pricing
NM_023977 Rosetta Predictions rat pricing
NM_025673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355527 predicted 1119
2 SASI_Hs01_00133692 predicted 1272
3 SASI_Hs01_00133693 predicted 837
4 SASI_Hs01_00133694 predicted 618
5 SASI_Hs01_00133695 predicted 632
6 SASI_Hs02_00355528 predicted 787
7 SASI_Hs01_00133697 predicted 706
8 SASI_Hs02_00355529 predicted 844
9 SASI_Hs01_00133699 predicted 937
10 SASI_Hs02_00355530 predicted 588
11 SASI_Hs01_00133690 predicted 933
12 SASI_Hs01_00133691 predicted 1106
13 SASI_Hs01_00133696 predicted 853
14 SASI_Hs01_00133698 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263798 predicted 1213
2 SASI_Rn01_00050316 predicted 944
3 SASI_Rn01_00050317 predicted 1188
4 SASI_Rn01_00050318 predicted 1068
5 SASI_Rn01_00050319 predicted 777
6 SASI_Rn01_00050320 predicted 507
7 SASI_Rn01_00050322 predicted 617
8 SASI_Rn01_00050323 predicted 1071
9 SASI_Rn01_00050324 predicted 1002
10 SASI_Rn01_00050325 predicted 779
11 SASI_Rn01_00050321 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328810 predicted 596
2 SASI_Mm01_00024066 predicted 827
3 SASI_Mm01_00024067 predicted 1119
4 SASI_Mm01_00024068 predicted 1196
5 SASI_Mm01_00024069 predicted 1127
6 SASI_Mm01_00024070 predicted 902
7 SASI_Mm01_00024072 predicted 1283
8 SASI_Mm01_00024073 predicted 747
9 SASI_Mm01_00024074 predicted 902
10 SASI_Mm01_00024075 predicted 888
11 SASI_Mm01_00024071 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025673
VALIDATED
GOLPH3 MISSION shRNA Bacterial Glycerol Stock
golgi phosphoprotein 3 (coat-protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-1013s21c1
Sequence:CCGGGCAGTATGATCTAGCCACCAACTCGAGTTGGTGGCTAGATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-455s21c1
Sequence:CCGGCCGAGAGGGTTACACATCATTCTCGAGAATGATGTGTAACCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-894s21c1
Sequence:CCGGGCTGTTCTTGACAAATGGGTACTCGAGTACCCATTTGTCAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-504s21c1
Sequence:CCGGCGTGGCTGTATGTTAATTGAACTCGAGTTCAATTAACATACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025673.2-1218s21c3
Sequence:CCGGCCCACACTAATAATTGGCTTTCTCGAGAAAGCCAATTATTAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-1218s1c1
Sequence:CCGGCCCACACTAATAATTGGCTTTCTCGAGAAAGCCAATTATTAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-1013s1c1
Sequence:CCGGGCAGTATGATCTAGCCACCAACTCGAGTTGGTGGCTAGATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025673.2-455s1c1
Sequence:CCGGCCGAGAGGGTTACACATCATTCTCGAGAATGATGTGTAACCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-894s1c1
Sequence:CCGGGCTGTTCTTGACAAATGGGTACTCGAGTACCCATTTGTCAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025673.2-504s1c1
Sequence:CCGGCGTGGCTGTATGTTAATTGAACTCGAGTTCAATTAACATACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025673
VALIDATED
GOLPH3 MISSION shRNA shRNA Plasmid DNA
golgi phosphoprotein 3 (coat-protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-1013s21c1
Sequence:CCGGGCAGTATGATCTAGCCACCAACTCGAGTTGGTGGCTAGATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-455s21c1
Sequence:CCGGCCGAGAGGGTTACACATCATTCTCGAGAATGATGTGTAACCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-894s21c1
Sequence:CCGGGCTGTTCTTGACAAATGGGTACTCGAGTACCCATTTGTCAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-504s21c1
Sequence:CCGGCGTGGCTGTATGTTAATTGAACTCGAGTTCAATTAACATACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025673.2-1218s21c3
Sequence:CCGGCCCACACTAATAATTGGCTTTCTCGAGAAAGCCAATTATTAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-1218s1c1
Sequence:CCGGCCCACACTAATAATTGGCTTTCTCGAGAAAGCCAATTATTAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-1013s1c1
Sequence:CCGGGCAGTATGATCTAGCCACCAACTCGAGTTGGTGGCTAGATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025673.2-455s1c1
Sequence:CCGGCCGAGAGGGTTACACATCATTCTCGAGAATGATGTGTAACCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-894s1c1
Sequence:CCGGGCTGTTCTTGACAAATGGGTACTCGAGTACCCATTTGTCAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025673.2-504s1c1
Sequence:CCGGCGTGGCTGTATGTTAATTGAACTCGAGTTCAATTAACATACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025673
VALIDATED
GOLPH3 MISSION shRNA Lentiviral Transduction Particles
golgi phosphoprotein 3 (coat-protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-1013s21c1
Sequence:CCGGGCAGTATGATCTAGCCACCAACTCGAGTTGGTGGCTAGATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-455s21c1
Sequence:CCGGCCGAGAGGGTTACACATCATTCTCGAGAATGATGTGTAACCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-894s21c1
Sequence:CCGGGCTGTTCTTGACAAATGGGTACTCGAGTACCCATTTGTCAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025673.2-504s21c1
Sequence:CCGGCGTGGCTGTATGTTAATTGAACTCGAGTTCAATTAACATACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025673.2-1218s21c3
Sequence:CCGGCCCACACTAATAATTGGCTTTCTCGAGAAAGCCAATTATTAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-1218s1c1
Sequence:CCGGCCCACACTAATAATTGGCTTTCTCGAGAAAGCCAATTATTAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-1013s1c1
Sequence:CCGGGCAGTATGATCTAGCCACCAACTCGAGTTGGTGGCTAGATCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025673.2-455s1c1
Sequence:CCGGCCGAGAGGGTTACACATCATTCTCGAGAATGATGTGTAACCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025673.2-894s1c1
Sequence:CCGGGCTGTTCTTGACAAATGGGTACTCGAGTACCCATTTGTCAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025673.2-504s1c1
Sequence:CCGGCGTGGCTGTATGTTAATTGAACTCGAGTTCAATTAACATACAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022130
GOLPH3 MISSION shRNA Bacterial Glycerol Stock
golgi phosphoprotein 3 (coat-protein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022130.3-1936s21c1
Sequence:CCGGGCTTGCTTCAATCATGGTTATCTCGAGATAACCATGATTGAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-790s21c1
Sequence:CCGGCAGTTAAGAAATGTACGGGAACTCGAGTTCCCGTACATTTCTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-853s21c1
Sequence:CCGGGAGAAACAGAACTTCCTACTTCTCGAGAAGTAGGAAGTTCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-604s21c1
Sequence:CCGGGCTTGTGGAATGAGACGTAAACTCGAGTTTACGTCTCATTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022130.3-1936s1c1
Sequence:CCGGGCTTGCTTCAATCATGGTTATCTCGAGATAACCATGATTGAAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-604s1c1
Sequence:CCGGGCTTGTGGAATGAGACGTAAACTCGAGTTTACGTCTCATTCCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-945s1c1
Sequence:CCGGCGTTCTTGACAAATGGGTGAACTCGAGTTCACCCATTTGTCAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-853s1c1
Sequence:CCGGGAGAAACAGAACTTCCTACTTCTCGAGAAGTAGGAAGTTCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-790s1c1
Sequence:CCGGCAGTTAAGAAATGTACGGGAACTCGAGTTCCCGTACATTTCTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022130
GOLPH3 MISSION shRNA shRNA Plasmid DNA
golgi phosphoprotein 3 (coat-protein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022130.3-1936s21c1
Sequence:CCGGGCTTGCTTCAATCATGGTTATCTCGAGATAACCATGATTGAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-790s21c1
Sequence:CCGGCAGTTAAGAAATGTACGGGAACTCGAGTTCCCGTACATTTCTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-853s21c1
Sequence:CCGGGAGAAACAGAACTTCCTACTTCTCGAGAAGTAGGAAGTTCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-604s21c1
Sequence:CCGGGCTTGTGGAATGAGACGTAAACTCGAGTTTACGTCTCATTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022130.3-1936s1c1
Sequence:CCGGGCTTGCTTCAATCATGGTTATCTCGAGATAACCATGATTGAAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-604s1c1
Sequence:CCGGGCTTGTGGAATGAGACGTAAACTCGAGTTTACGTCTCATTCCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-945s1c1
Sequence:CCGGCGTTCTTGACAAATGGGTGAACTCGAGTTCACCCATTTGTCAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-853s1c1
Sequence:CCGGGAGAAACAGAACTTCCTACTTCTCGAGAAGTAGGAAGTTCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-790s1c1
Sequence:CCGGCAGTTAAGAAATGTACGGGAACTCGAGTTCCCGTACATTTCTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022130
GOLPH3 MISSION shRNA Lentiviral Transduction Particles
golgi phosphoprotein 3 (coat-protein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022130.3-1936s21c1
Sequence:CCGGGCTTGCTTCAATCATGGTTATCTCGAGATAACCATGATTGAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-790s21c1
Sequence:CCGGCAGTTAAGAAATGTACGGGAACTCGAGTTCCCGTACATTTCTTAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-853s21c1
Sequence:CCGGGAGAAACAGAACTTCCTACTTCTCGAGAAGTAGGAAGTTCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022130.3-604s21c1
Sequence:CCGGGCTTGTGGAATGAGACGTAAACTCGAGTTTACGTCTCATTCCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022130.3-1936s1c1
Sequence:CCGGGCTTGCTTCAATCATGGTTATCTCGAGATAACCATGATTGAAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-604s1c1
Sequence:CCGGGCTTGTGGAATGAGACGTAAACTCGAGTTTACGTCTCATTCCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-945s1c1
Sequence:CCGGCGTTCTTGACAAATGGGTGAACTCGAGTTCACCCATTTGTCAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-853s1c1
Sequence:CCGGGAGAAACAGAACTTCCTACTTCTCGAGAAGTAGGAAGTTCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022130.3-790s1c1
Sequence:CCGGCAGTTAAGAAATGTACGGGAACTCGAGTTCCCGTACATTTCTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks