EMAIL THIS PAGE TO A FRIEND

GOLPH3L

golgi phosphoprotein 3-like

Synonyms: GPP34R
UniProtKB ID: Q9H4A5, B1AN09, Q9NVK0
Gene ID:
Human(55204) Summary: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is localized at the Golgi stack and may have a regulatory role in Golgi trafficking. [provided by RefSeq, Jul 2008]
Mouse(229593) golgi phosphoprotein 3-like
Rat(310669) golgi phosphoprotein 3-like
Zebrafish(569617) golgi phosphoprotein 3-like
cow(532555) golgi phosphoprotein 3-like
domestic cat(101090200) golgi phosphoprotein 3-like
dog(475838) golgi phosphoprotein 3-like
chicken(425072) golgi phosphoprotein 3-like
domestic guinea pig(100721942) golgi phosphoprotein 3-like
naked mole-rat(101726422) golgi phosphoprotein 3-like
sheep(101107318) golgi phosphoprotein 3-like
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018178 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018178 Rosetta Predictions human pricing
NM_001007698 Rosetta Predictions rat pricing
XM_575073 Rosetta Predictions rat pricing
NM_146133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163826 predicted 303
2 SASI_Hs01_00163830 predicted 363
3 SASI_Hs02_00351432 predicted 865
4 SASI_Hs01_00163831 predicted 675
5 SASI_Hs01_00163832 predicted 751
6 SASI_Hs01_00163833 predicted 481
7 SASI_Hs01_00163834 predicted 971
8 SASI_Hs02_00351433 predicted 328
9 SASI_Hs02_00351434 predicted 670
10 SASI_Hs01_00163835 predicted 752
11 SASI_Hs01_00163827 predicted 578
12 SASI_Hs01_00163828 predicted 557
13 SASI_Hs01_00163829 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067370 predicted 725
2 SASI_Rn01_00067371 predicted 718
3 SASI_Rn01_00067372 predicted 729
4 SASI_Rn01_00067373 predicted 700
5 SASI_Rn01_00067376 predicted 727
6 SASI_Rn01_00067377 predicted 343
7 SASI_Rn01_00067378 predicted 952
8 SASI_Rn02_00198855 predicted 502
9 SASI_Rn02_00198856 predicted 433
10 SASI_Rn02_00198857 predicted 343
11 SASI_Rn01_00067374 predicted 1077
12 SASI_Rn01_00067375 predicted 1066
13 SASI_Rn01_00067379 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176181 predicted 589
2 SASI_Rn01_00176182 predicted 579
3 SASI_Rn01_00176183 predicted 594
4 SASI_Rn01_00176184 predicted 568
5 SASI_Rn01_00176185 predicted 933
6 SASI_Rn01_00176186 predicted 924
7 SASI_Rn01_00176187 predicted 598
8 SASI_Rn01_00176188 predicted 201
9 SASI_Rn01_00176189 predicted 817
10 SASI_Rn01_00176190 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072117 predicted 209
2 SASI_Mm01_00072118 predicted 935
3 SASI_Mm01_00072119 predicted 259
4 SASI_Mm01_00072120 predicted 755
5 SASI_Mm01_00072121 predicted 305
6 SASI_Mm01_00072122 predicted 785
7 SASI_Mm01_00072123 predicted 611
8 SASI_Mm01_00072124 predicted 799
9 SASI_Mm01_00072125 predicted 948
10 SASI_Mm01_00072126 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146133
VALIDATED
GOLPH3L MISSION shRNA Bacterial Glycerol Stock
golgi phosphoprotein 3-like
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-2114s1c1
Sequence:CCGGCCCTCTAAATTGTGTCTTCTTCTCGAGAAGAAGACACAATTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146133.2-293s1c1
Sequence:CCGGCCCTGGAGACTCTAAGGATATCTCGAGATATCCTTAGAGTCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-739s1c1
Sequence:CCGGCCACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146133.2-939s1c1
Sequence:CCGGCGAACCAAGGACCTAGTAGAACTCGAGTTCTACTAGGTCCTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-615s1c1
Sequence:CCGGGAGACATGGAACCCTTTCAAACTCGAGTTTGAAAGGGTTCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-535s21c1
Sequence:CCGGTGCTGGATGAGACGCTCAAACCTCGAGGTTTGAGCGTCTCATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146133.2-615s21c1
Sequence:CCGGGAGACATGGAACCCTTTCAAACTCGAGTTTGAAAGGGTTCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-739s21c1
Sequence:CCGGCCACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-1497s21c1
Sequence:CCGGCAGTGGGAACAAGACTAATTTCTCGAGAAATTAGTCTTGTTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-1113s21c1
Sequence:CCGGGATAAGATGCTATCATCATTTCTCGAGAAATGATGATAGCATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-761s21c1
Sequence:CCGGGACAGAGAAACAGCGACTAATCTCGAGATTAGTCGCTGTTTCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146133
VALIDATED
GOLPH3L MISSION shRNA shRNA Plasmid DNA
golgi phosphoprotein 3-like
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-2114s1c1
Sequence:CCGGCCCTCTAAATTGTGTCTTCTTCTCGAGAAGAAGACACAATTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146133.2-293s1c1
Sequence:CCGGCCCTGGAGACTCTAAGGATATCTCGAGATATCCTTAGAGTCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-739s1c1
Sequence:CCGGCCACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146133.2-939s1c1
Sequence:CCGGCGAACCAAGGACCTAGTAGAACTCGAGTTCTACTAGGTCCTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-615s1c1
Sequence:CCGGGAGACATGGAACCCTTTCAAACTCGAGTTTGAAAGGGTTCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-535s21c1
Sequence:CCGGTGCTGGATGAGACGCTCAAACCTCGAGGTTTGAGCGTCTCATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146133.2-615s21c1
Sequence:CCGGGAGACATGGAACCCTTTCAAACTCGAGTTTGAAAGGGTTCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-739s21c1
Sequence:CCGGCCACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-1497s21c1
Sequence:CCGGCAGTGGGAACAAGACTAATTTCTCGAGAAATTAGTCTTGTTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-1113s21c1
Sequence:CCGGGATAAGATGCTATCATCATTTCTCGAGAAATGATGATAGCATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-761s21c1
Sequence:CCGGGACAGAGAAACAGCGACTAATCTCGAGATTAGTCGCTGTTTCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146133
VALIDATED
GOLPH3L MISSION shRNA Lentiviral Transduction Particles
golgi phosphoprotein 3-like
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-2114s1c1
Sequence:CCGGCCCTCTAAATTGTGTCTTCTTCTCGAGAAGAAGACACAATTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146133.2-293s1c1
Sequence:CCGGCCCTGGAGACTCTAAGGATATCTCGAGATATCCTTAGAGTCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-739s1c1
Sequence:CCGGCCACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146133.2-939s1c1
Sequence:CCGGCGAACCAAGGACCTAGTAGAACTCGAGTTCTACTAGGTCCTTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146133.2-615s1c1
Sequence:CCGGGAGACATGGAACCCTTTCAAACTCGAGTTTGAAAGGGTTCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-535s21c1
Sequence:CCGGTGCTGGATGAGACGCTCAAACCTCGAGGTTTGAGCGTCTCATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146133.2-615s21c1
Sequence:CCGGGAGACATGGAACCCTTTCAAACTCGAGTTTGAAAGGGTTCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-739s21c1
Sequence:CCGGCCACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-1497s21c1
Sequence:CCGGCAGTGGGAACAAGACTAATTTCTCGAGAAATTAGTCTTGTTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-1113s21c1
Sequence:CCGGGATAAGATGCTATCATCATTTCTCGAGAAATGATGATAGCATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146133.2-761s21c1
Sequence:CCGGGACAGAGAAACAGCGACTAATCTCGAGATTAGTCGCTGTTTCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018178
VALIDATED
GOLPH3L MISSION shRNA Bacterial Glycerol Stock
golgi phosphoprotein 3-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-827s1c1
Sequence:CCGGCGTATGGACAAGCGAACACTACTCGAGTAGTGTTCGCTTGTCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018178.3-1617s1c1
Sequence:CCGGCCCAGATTCAATTACCTGGATCTCGAGATCCAGGTAATTGAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-476s1c1
Sequence:CCGGCGACTACTAGACAGAAAGGTACTCGAGTACCTTTCTGTCTAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-667s1c1
Sequence:CCGGCGCAAAGAACCTAGTAGAGAACTCGAGTTCTCTACTAGGTTCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018178.3-310s1c1
Sequence:CCGGCCGCCTTACTCTTATGGAAGACTCGAGTCTTCCATAAGAGTAAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-1892s1c1
Sequence:CCGGGCAGGAGTACAGTAGTGCAATCTCGAGATTGCACTACTGTACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-774s21c1
Sequence:CCGGCTACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-1227s21c1
Sequence:CCGGCCATAGACCTTGACCATTATACTCGAGTATAATGGTCAAGGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-343s21c1
Sequence:CCGGGGATATCCGCCTTACTCTTATCTCGAGATAAGAGTAAGGCGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-837s21c1
Sequence:CCGGTACTAGAGCGGTGGGTAAATGCTCGAGCATTTACCCACCGCTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-706s21c1
Sequence:CCGGCGCAAAGAACCTAGTAGAGAACTCGAGTTCTCTACTAGGTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018178
VALIDATED
GOLPH3L MISSION shRNA shRNA Plasmid DNA
golgi phosphoprotein 3-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-827s1c1
Sequence:CCGGCGTATGGACAAGCGAACACTACTCGAGTAGTGTTCGCTTGTCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018178.3-1617s1c1
Sequence:CCGGCCCAGATTCAATTACCTGGATCTCGAGATCCAGGTAATTGAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-476s1c1
Sequence:CCGGCGACTACTAGACAGAAAGGTACTCGAGTACCTTTCTGTCTAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-667s1c1
Sequence:CCGGCGCAAAGAACCTAGTAGAGAACTCGAGTTCTCTACTAGGTTCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018178.3-310s1c1
Sequence:CCGGCCGCCTTACTCTTATGGAAGACTCGAGTCTTCCATAAGAGTAAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-1892s1c1
Sequence:CCGGGCAGGAGTACAGTAGTGCAATCTCGAGATTGCACTACTGTACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-774s21c1
Sequence:CCGGCTACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-1227s21c1
Sequence:CCGGCCATAGACCTTGACCATTATACTCGAGTATAATGGTCAAGGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-343s21c1
Sequence:CCGGGGATATCCGCCTTACTCTTATCTCGAGATAAGAGTAAGGCGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-837s21c1
Sequence:CCGGTACTAGAGCGGTGGGTAAATGCTCGAGCATTTACCCACCGCTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-706s21c1
Sequence:CCGGCGCAAAGAACCTAGTAGAGAACTCGAGTTCTCTACTAGGTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018178
VALIDATED
GOLPH3L MISSION shRNA Lentiviral Transduction Particles
golgi phosphoprotein 3-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-827s1c1
Sequence:CCGGCGTATGGACAAGCGAACACTACTCGAGTAGTGTTCGCTTGTCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018178.3-1617s1c1
Sequence:CCGGCCCAGATTCAATTACCTGGATCTCGAGATCCAGGTAATTGAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-476s1c1
Sequence:CCGGCGACTACTAGACAGAAAGGTACTCGAGTACCTTTCTGTCTAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-667s1c1
Sequence:CCGGCGCAAAGAACCTAGTAGAGAACTCGAGTTCTCTACTAGGTTCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018178.3-310s1c1
Sequence:CCGGCCGCCTTACTCTTATGGAAGACTCGAGTCTTCCATAAGAGTAAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018178.3-1892s1c1
Sequence:CCGGGCAGGAGTACAGTAGTGCAATCTCGAGATTGCACTACTGTACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-774s21c1
Sequence:CCGGCTACTCATCCAGTGACCAATACTCGAGTATTGGTCACTGGATGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-1227s21c1
Sequence:CCGGCCATAGACCTTGACCATTATACTCGAGTATAATGGTCAAGGTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-343s21c1
Sequence:CCGGGGATATCCGCCTTACTCTTATCTCGAGATAAGAGTAAGGCGGATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-837s21c1
Sequence:CCGGTACTAGAGCGGTGGGTAAATGCTCGAGCATTTACCCACCGCTCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018178.5-706s21c1
Sequence:CCGGCGCAAAGAACCTAGTAGAGAACTCGAGTTCTCTACTAGGTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks