EMAIL THIS PAGE TO A FRIEND

GOLT1A

golgi transport 1A

60 Gene Product Result for
Synonyms: CGI-141 GOT1 HMFN1187 RP11-203F10.3 YMR292W
UniProtKB ID: Q6ZVE7
Gene ID:
Mouse(68338) golgi transport 1 homolog A (S. cerevisiae)
Rat(498230) golgi transport 1A
chicken(771662) golgi transport 1A
cow(508464) golgi transport 1A
domestic cat(101081948) golgi transport 1A
dog(606914) golgi transport 1A
sheep(101107979) golgi transport 1A
domestic guinea pig(100723753) golgi transport 1A
naked mole-rat(101723904) golgi transport 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500365 Anti-GOLT1A antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB1303735 ANTI-GOT1A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198447 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015651 MISSION® esiRNA esiRNA targeting human GOLT1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198447 Rosetta Predictions human pricing
NM_001109070 Rosetta Predictions rat pricing
NM_026680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206862 predicted 220
2 SASI_Hs01_00206863 predicted 556
3 SASI_Hs01_00206864 predicted 364
4 SASI_Hs01_00206865 predicted 587
5 SASI_Hs01_00206866 predicted 558
6 SASI_Hs01_00206867 predicted 260
7 SASI_Hs01_00206868 predicted 543
8 SASI_Hs01_00206869 predicted 564
9 SASI_Hs01_00206870 predicted 584
10 SASI_Hs01_00206871 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244830 predicted 352
2 SASI_Rn02_00244831 predicted 396
3 SASI_Rn02_00244832 predicted 250
4 SASI_Rn02_00244833 predicted 252
5 SASI_Rn02_00244834 predicted 397
6 SASI_Rn02_00244835 predicted 223
7 SASI_Rn02_00244836 predicted 501
8 SASI_Rn02_00244837 predicted 451
9 SASI_Rn02_00244838 predicted 344
10 SASI_Rn02_00244839 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330711 predicted 854
2 SASI_Mm01_00084395 predicted 561
3 SASI_Mm02_00330712 predicted 933
4 SASI_Mm01_00084398 predicted 747
5 SASI_Mm01_00084399 predicted 380
6 SASI_Mm01_00084401 predicted 316
7 SASI_Mm02_00330713 predicted 907
8 SASI_Mm01_00084402 predicted 652
9 SASI_Mm02_00330714 predicted 218
10 SASI_Mm02_00330715 predicted 790
11 SASI_Mm01_00084396 predicted 765
12 SASI_Mm01_00084397 predicted 708
13 SASI_Mm01_00084400 predicted 741
14 SASI_Mm01_00084403 predicted 378
15 SASI_Mm01_00084404 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198447
GOLT1A MISSION shRNA Bacterial Glycerol Stock
golgi transport 1A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-365s21c1
Sequence:CCGGTCCAACGGCACAAACTCAAGGCTCGAGCCTTGAGTTTGTGCCGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-566s21c1
Sequence:CCGGGCACTAGCTCGATGGTCTGAACTCGAGTTCAGACCATCGAGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-225s21c1
Sequence:CCGGGATCACCGGTTTCGGCATCTTCTCGAGAAGATGCCGAAACCGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198447.1-725s21c1
Sequence:CCGGGCTGAGCAACTGACGTCAAATCTCGAGATTTGACGTCAGTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-407s21c1
Sequence:CCGGGTGTGGTTATCGTGCTCCTACCTCGAGGTAGGAGCACGATAACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-255s1c1
Sequence:CCGGCTTTGGAACACTCCTGTACTTCTCGAGAAGTACAGGAGTGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-462s1c1
Sequence:CCGGCGGATTCTTCAGCCTCTTTAACTCGAGTTAAAGAGGCTGAAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-260s1c1
Sequence:CCGGGAACACTCCTGTACTTTGATTCTCGAGAATCAAAGTACAGGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198447.1-599s1c1
Sequence:CCGGGCTCCTTGAACTTGGATCATTCTCGAGAATGATCCAAGTTCAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-267s1c1
Sequence:CCGGCCTGTACTTTGATTCCGTGCTCTCGAGAGCACGGAATCAAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198447
GOLT1A MISSION shRNA shRNA Plasmid DNA
golgi transport 1A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-365s21c1
Sequence:CCGGTCCAACGGCACAAACTCAAGGCTCGAGCCTTGAGTTTGTGCCGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-566s21c1
Sequence:CCGGGCACTAGCTCGATGGTCTGAACTCGAGTTCAGACCATCGAGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-225s21c1
Sequence:CCGGGATCACCGGTTTCGGCATCTTCTCGAGAAGATGCCGAAACCGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198447.1-725s21c1
Sequence:CCGGGCTGAGCAACTGACGTCAAATCTCGAGATTTGACGTCAGTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-407s21c1
Sequence:CCGGGTGTGGTTATCGTGCTCCTACCTCGAGGTAGGAGCACGATAACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-255s1c1
Sequence:CCGGCTTTGGAACACTCCTGTACTTCTCGAGAAGTACAGGAGTGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-462s1c1
Sequence:CCGGCGGATTCTTCAGCCTCTTTAACTCGAGTTAAAGAGGCTGAAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-260s1c1
Sequence:CCGGGAACACTCCTGTACTTTGATTCTCGAGAATCAAAGTACAGGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198447.1-599s1c1
Sequence:CCGGGCTCCTTGAACTTGGATCATTCTCGAGAATGATCCAAGTTCAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-267s1c1
Sequence:CCGGCCTGTACTTTGATTCCGTGCTCTCGAGAGCACGGAATCAAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198447
GOLT1A MISSION shRNA Lentiviral Transduction Particles
golgi transport 1A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-365s21c1
Sequence:CCGGTCCAACGGCACAAACTCAAGGCTCGAGCCTTGAGTTTGTGCCGTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-566s21c1
Sequence:CCGGGCACTAGCTCGATGGTCTGAACTCGAGTTCAGACCATCGAGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-225s21c1
Sequence:CCGGGATCACCGGTTTCGGCATCTTCTCGAGAAGATGCCGAAACCGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198447.1-725s21c1
Sequence:CCGGGCTGAGCAACTGACGTCAAATCTCGAGATTTGACGTCAGTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198447.1-407s21c1
Sequence:CCGGGTGTGGTTATCGTGCTCCTACCTCGAGGTAGGAGCACGATAACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-255s1c1
Sequence:CCGGCTTTGGAACACTCCTGTACTTCTCGAGAAGTACAGGAGTGTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-462s1c1
Sequence:CCGGCGGATTCTTCAGCCTCTTTAACTCGAGTTAAAGAGGCTGAAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-260s1c1
Sequence:CCGGGAACACTCCTGTACTTTGATTCTCGAGAATCAAAGTACAGGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198447.1-599s1c1
Sequence:CCGGGCTCCTTGAACTTGGATCATTCTCGAGAATGATCCAAGTTCAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198447.1-267s1c1
Sequence:CCGGCCTGTACTTTGATTCCGTGCTCTCGAGAGCACGGAATCAAAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026680
VALIDATED
GOLT1A MISSION shRNA Bacterial Glycerol Stock
golgi transport 1A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-385s21c1
Sequence:CCGGCTTCCTGGGCAGTGCGTTTAACTCGAGTTAAACGCACTGCCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-135s21c1
Sequence:CCGGTTGGGATTCTCCTGTACTTTGCTCGAGCAAAGTACAGGAGAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026680.4-330s21c1
Sequence:CCGGTGGAGGCCTATGGCTTCATTACTCGAGTAATGAAGCCATAGGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-607s21c1
Sequence:CCGGAGCTGAGTGATCGATCTTAAACTCGAGTTTAAGATCGATCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-235s21c1
Sequence:CCGGCTTCTTCTTCCAACGGCACAACTCGAGTTGTGCCGTTGGAAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-141s1c1
Sequence:CCGGCTTTGGGATTCTCCTGTACTTCTCGAGAAGTACAGGAGAATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026680.1-589s1c1
Sequence:CCGGCATCTCCAAGTCCAGAAGAAACTCGAGTTTCTTCTGGACTTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-243s1c1
Sequence:CCGGCTTCTTCTTCCAACGGCACAACTCGAGTTGTGCCGTTGGAAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-156s1c1
Sequence:CCGGGTACTTTGACTCCGTGCTCTTCTCGAGAAGAGCACGGAGTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026680
VALIDATED
GOLT1A MISSION shRNA shRNA Plasmid DNA
golgi transport 1A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-385s21c1
Sequence:CCGGCTTCCTGGGCAGTGCGTTTAACTCGAGTTAAACGCACTGCCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-135s21c1
Sequence:CCGGTTGGGATTCTCCTGTACTTTGCTCGAGCAAAGTACAGGAGAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026680.4-330s21c1
Sequence:CCGGTGGAGGCCTATGGCTTCATTACTCGAGTAATGAAGCCATAGGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-607s21c1
Sequence:CCGGAGCTGAGTGATCGATCTTAAACTCGAGTTTAAGATCGATCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-235s21c1
Sequence:CCGGCTTCTTCTTCCAACGGCACAACTCGAGTTGTGCCGTTGGAAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-141s1c1
Sequence:CCGGCTTTGGGATTCTCCTGTACTTCTCGAGAAGTACAGGAGAATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026680.1-589s1c1
Sequence:CCGGCATCTCCAAGTCCAGAAGAAACTCGAGTTTCTTCTGGACTTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-243s1c1
Sequence:CCGGCTTCTTCTTCCAACGGCACAACTCGAGTTGTGCCGTTGGAAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-156s1c1
Sequence:CCGGGTACTTTGACTCCGTGCTCTTCTCGAGAAGAGCACGGAGTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026680
VALIDATED
GOLT1A MISSION shRNA Lentiviral Transduction Particles
golgi transport 1A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-385s21c1
Sequence:CCGGCTTCCTGGGCAGTGCGTTTAACTCGAGTTAAACGCACTGCCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-135s21c1
Sequence:CCGGTTGGGATTCTCCTGTACTTTGCTCGAGCAAAGTACAGGAGAATCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026680.4-330s21c1
Sequence:CCGGTGGAGGCCTATGGCTTCATTACTCGAGTAATGAAGCCATAGGCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-607s21c1
Sequence:CCGGAGCTGAGTGATCGATCTTAAACTCGAGTTTAAGATCGATCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026680.4-235s21c1
Sequence:CCGGCTTCTTCTTCCAACGGCACAACTCGAGTTGTGCCGTTGGAAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-141s1c1
Sequence:CCGGCTTTGGGATTCTCCTGTACTTCTCGAGAAGTACAGGAGAATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026680.1-589s1c1
Sequence:CCGGCATCTCCAAGTCCAGAAGAAACTCGAGTTTCTTCTGGACTTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-243s1c1
Sequence:CCGGCTTCTTCTTCCAACGGCACAACTCGAGTTGTGCCGTTGGAAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026680.1-156s1c1
Sequence:CCGGGTACTTTGACTCCGTGCTCTTCTCGAGAAGAGCACGGAGTCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks