EMAIL THIS PAGE TO A FRIEND

GOLT1B

golgi transport 1B

164 Gene Product Result for
Synonyms: GCT2 GOT1 GOT1B YMR292W
UniProtKB ID: Q9Y3E0, B2R4R4, Q54A40, Q6I9W6, Q9P1R9
Gene ID:
Mouse(66964) golgi transport 1 homolog B (S. cerevisiae)
Rat(362460) golgi transport 1B
domestic guinea pig(100714576) golgi transport 1B
naked mole-rat(101697452) golgi transport 1B
sheep(101119200) golgi transport 1B
chicken(418192) golgi transport 1B
domestic cat(101091881) golgi transport 1B
cow(515866) golgi transport 1B
dog(612957) golgi transport 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005701 MISSION® esiRNA esiRNA targeting human GOLT1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016072 Rosetta Predictions human pricing
NM_001113783 Rosetta Predictions rat pricing
NM_025872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171739 predicted 450
2 SASI_Hs02_00348814 predicted 370
3 SASI_Hs01_00171740 predicted 478
4 SASI_Hs01_00171741 predicted 647
5 SASI_Hs01_00171742 predicted 574
6 SASI_Hs01_00171743 predicted 306
7 SASI_Hs01_00171744 predicted 520
8 SASI_Hs01_00171745 predicted 283
9 SASI_Hs02_00348815 predicted 724
10 SASI_Hs01_00171746 predicted 478
11 SASI_Hs01_00171747 predicted 688
12 SASI_Hs01_00171748 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252093 predicted 205
2 SASI_Rn02_00252094 predicted 506
3 SASI_Rn02_00252095 predicted 304
4 SASI_Rn02_00252096 predicted 556
5 SASI_Rn02_00252097 predicted 313
6 SASI_Rn02_00252098 predicted 436
7 SASI_Rn02_00252099 predicted 338
8 SASI_Rn02_00252100 predicted 472
9 SASI_Rn02_00252101 predicted 312
10 SASI_Rn02_00252102 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055713 predicted 466
2 SASI_Mm01_00055714 predicted 358
3 SASI_Mm01_00055715 predicted 410
4 SASI_Mm01_00055716 predicted 558
5 SASI_Mm01_00055717 predicted 364
6 SASI_Mm01_00055718 predicted 348
7 SASI_Mm01_00055719 predicted 257
8 SASI_Mm01_00055720 predicted 330
9 SASI_Mm01_00055721 predicted 596
10 SASI_Mm01_00055722 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016072
VALIDATED
GOLT1B MISSION shRNA Bacterial Glycerol Stock
golgi transport 1B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-1159s1c1
Sequence:CCGGCCGGAAAGTCTCATACTTCTTCTCGAGAAGAAGTATGAGACTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-310s1c1
Sequence:CCGGGATAGGCATGATCTTCGAAATCTCGAGATTTCGAAGATCATGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-121s1c1
Sequence:CCGGCCTGTTCTTTGGAATGATTCTCTCGAGAGAATCATTCCAAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-292s1c1
Sequence:CCGGCCTTATTGGTTGGCCTTTGATCTCGAGATCAAAGGCCAACCAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-2308s1c1
Sequence:CCGGGCAAGAATAGTATCTGCTAATCTCGAGATTAGCAGATACTATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-2628s1c1
Sequence:CCGGGCACTATACATCCTATTGTTTCTCGAGAAACAATAGGATGTATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-124s1c1
Sequence:CCGGGTTCTTTGGAATGATTCTCTTCTCGAGAAGAGAATCATTCCAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-304s1c1
Sequence:CCGGGCCTTTGATAGGCATGATCTTCTCGAGAAGATCATGCCTATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016072.2-149s1c1
Sequence:CCGGGACAAAGCACTACTGGCTATTCTCGAGAATAGCCAGTAGTGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-393s21c1
Sequence:CCGGCCTTATTGGTTGGCCTTTGATCTCGAGATCAAAGGCCAACCAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-411s21c1
Sequence:CCGGGATAGGCATGATCTTCGAAATCTCGAGATTTCGAAGATCATGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-222s21c1
Sequence:CCGGCCTGTTCTTTGGAATGATTCTCTCGAGAGAATCATTCCAAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016072.4-2728s21c1
Sequence:CCGGGCACTATACATCCTATTGTTTCTCGAGAAACAATAGGATGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016072
VALIDATED
GOLT1B MISSION shRNA shRNA Plasmid DNA
golgi transport 1B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-1159s1c1
Sequence:CCGGCCGGAAAGTCTCATACTTCTTCTCGAGAAGAAGTATGAGACTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-310s1c1
Sequence:CCGGGATAGGCATGATCTTCGAAATCTCGAGATTTCGAAGATCATGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-121s1c1
Sequence:CCGGCCTGTTCTTTGGAATGATTCTCTCGAGAGAATCATTCCAAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-292s1c1
Sequence:CCGGCCTTATTGGTTGGCCTTTGATCTCGAGATCAAAGGCCAACCAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-2308s1c1
Sequence:CCGGGCAAGAATAGTATCTGCTAATCTCGAGATTAGCAGATACTATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-2628s1c1
Sequence:CCGGGCACTATACATCCTATTGTTTCTCGAGAAACAATAGGATGTATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-124s1c1
Sequence:CCGGGTTCTTTGGAATGATTCTCTTCTCGAGAAGAGAATCATTCCAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-304s1c1
Sequence:CCGGGCCTTTGATAGGCATGATCTTCTCGAGAAGATCATGCCTATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016072.2-149s1c1
Sequence:CCGGGACAAAGCACTACTGGCTATTCTCGAGAATAGCCAGTAGTGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-393s21c1
Sequence:CCGGCCTTATTGGTTGGCCTTTGATCTCGAGATCAAAGGCCAACCAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-411s21c1
Sequence:CCGGGATAGGCATGATCTTCGAAATCTCGAGATTTCGAAGATCATGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-222s21c1
Sequence:CCGGCCTGTTCTTTGGAATGATTCTCTCGAGAGAATCATTCCAAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016072.4-2728s21c1
Sequence:CCGGGCACTATACATCCTATTGTTTCTCGAGAAACAATAGGATGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016072
VALIDATED
GOLT1B MISSION shRNA Lentiviral Transduction Particles
golgi transport 1B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136775    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-1159s1c1
Sequence:CCGGCCGGAAAGTCTCATACTTCTTCTCGAGAAGAAGTATGAGACTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-310s1c1
Sequence:CCGGGATAGGCATGATCTTCGAAATCTCGAGATTTCGAAGATCATGCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-121s1c1
Sequence:CCGGCCTGTTCTTTGGAATGATTCTCTCGAGAGAATCATTCCAAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-292s1c1
Sequence:CCGGCCTTATTGGTTGGCCTTTGATCTCGAGATCAAAGGCCAACCAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-2308s1c1
Sequence:CCGGGCAAGAATAGTATCTGCTAATCTCGAGATTAGCAGATACTATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-2628s1c1
Sequence:CCGGGCACTATACATCCTATTGTTTCTCGAGAAACAATAGGATGTATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016072.2-124s1c1
Sequence:CCGGGTTCTTTGGAATGATTCTCTTCTCGAGAAGAGAATCATTCCAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016072.2-304s1c1
Sequence:CCGGGCCTTTGATAGGCATGATCTTCTCGAGAAGATCATGCCTATCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016072.2-149s1c1
Sequence:CCGGGACAAAGCACTACTGGCTATTCTCGAGAATAGCCAGTAGTGCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-393s21c1
Sequence:CCGGCCTTATTGGTTGGCCTTTGATCTCGAGATCAAAGGCCAACCAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-411s21c1
Sequence:CCGGGATAGGCATGATCTTCGAAATCTCGAGATTTCGAAGATCATGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016072.4-222s21c1
Sequence:CCGGCCTGTTCTTTGGAATGATTCTCTCGAGAGAATCATTCCAAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016072.4-2728s21c1
Sequence:CCGGGCACTATACATCCTATTGTTTCTCGAGAAACAATAGGATGTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025872
VALIDATED
GOLT1B MISSION shRNA Bacterial Glycerol Stock
golgi transport 1B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-259s1c1
Sequence:CCGGCGAGAGAACGTTCAGATTCTTCTCGAGAAGAATCTGAACGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-467s1c1
Sequence:CCGGCCTGGAATCAGATCATTCGTACTCGAGTACGAATGATCTGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025872.3-419s1c1
Sequence:CCGGGTTGGCTTTATCAGAAGAGTACTCGAGTACTCTTCTGATAAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-1484s1c1
Sequence:CCGGGCTGATTACTTCATCTTGATTCTCGAGAATCAAGATGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-349s1c1
Sequence:CCGGGCCTCTGATAGGCATGATCTTCTCGAGAAGATCATGCCTATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-443s21c1
Sequence:CCGGTCCTCGGATCCCTCCTAAATCCTCGAGGATTTAGGAGGGATCCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-595s21c1
Sequence:CCGGTTCACGAACTAGGGTGTAAAGCTCGAGCTTTACACCCTAGTTCGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-499s21c1
Sequence:CCGGGAAAGCAACAATATGGTATAACTCGAGTTATACCATATTGTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-466s21c1
Sequence:CCGGCCTGGAATCAGATCATTCGTACTCGAGTACGAATGATCTGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025872.4-258s21c1
Sequence:CCGGCGAGAGAACGTTCAGATTCTTCTCGAGAAGAATCTGAACGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025872
VALIDATED
GOLT1B MISSION shRNA shRNA Plasmid DNA
golgi transport 1B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-259s1c1
Sequence:CCGGCGAGAGAACGTTCAGATTCTTCTCGAGAAGAATCTGAACGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-467s1c1
Sequence:CCGGCCTGGAATCAGATCATTCGTACTCGAGTACGAATGATCTGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025872.3-419s1c1
Sequence:CCGGGTTGGCTTTATCAGAAGAGTACTCGAGTACTCTTCTGATAAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-1484s1c1
Sequence:CCGGGCTGATTACTTCATCTTGATTCTCGAGAATCAAGATGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-349s1c1
Sequence:CCGGGCCTCTGATAGGCATGATCTTCTCGAGAAGATCATGCCTATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-443s21c1
Sequence:CCGGTCCTCGGATCCCTCCTAAATCCTCGAGGATTTAGGAGGGATCCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-595s21c1
Sequence:CCGGTTCACGAACTAGGGTGTAAAGCTCGAGCTTTACACCCTAGTTCGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-499s21c1
Sequence:CCGGGAAAGCAACAATATGGTATAACTCGAGTTATACCATATTGTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-466s21c1
Sequence:CCGGCCTGGAATCAGATCATTCGTACTCGAGTACGAATGATCTGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025872.4-258s21c1
Sequence:CCGGCGAGAGAACGTTCAGATTCTTCTCGAGAAGAATCTGAACGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025872
VALIDATED
GOLT1B MISSION shRNA Lentiviral Transduction Particles
golgi transport 1B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-259s1c1
Sequence:CCGGCGAGAGAACGTTCAGATTCTTCTCGAGAAGAATCTGAACGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-467s1c1
Sequence:CCGGCCTGGAATCAGATCATTCGTACTCGAGTACGAATGATCTGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025872.3-419s1c1
Sequence:CCGGGTTGGCTTTATCAGAAGAGTACTCGAGTACTCTTCTGATAAAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-1484s1c1
Sequence:CCGGGCTGATTACTTCATCTTGATTCTCGAGAATCAAGATGAAGTAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025872.3-349s1c1
Sequence:CCGGGCCTCTGATAGGCATGATCTTCTCGAGAAGATCATGCCTATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-443s21c1
Sequence:CCGGTCCTCGGATCCCTCCTAAATCCTCGAGGATTTAGGAGGGATCCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-595s21c1
Sequence:CCGGTTCACGAACTAGGGTGTAAAGCTCGAGCTTTACACCCTAGTTCGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-499s21c1
Sequence:CCGGGAAAGCAACAATATGGTATAACTCGAGTTATACCATATTGTTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025872.4-466s21c1
Sequence:CCGGCCTGGAATCAGATCATTCGTACTCGAGTACGAATGATCTGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025872.4-258s21c1
Sequence:CCGGCGAGAGAACGTTCAGATTCTTCTCGAGAAGAATCTGAACGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks