EMAIL THIS PAGE TO A FRIEND

GON4L

gon-4-like (C. elegans)

116 Gene Product Result for
Synonyms: GON-4 GON4 RP11-243J18.4 YARP
Gene ID:
Mouse(76022) gon-4-like (C.elegans)
Rat(499653) gon-4-like (C. elegans)
Zebrafish(555764) gon-4-like (C.elegans)
chicken(425067) gon-4-like (C. elegans)
domestic cat(101087446) gon-4-like (C. elegans)
dog(490422) gon-4-like (C. elegans)
Horse(100057465) gon-4-like (C. elegans)
cow(526125) gon-4-like (C. elegans)
Domestic Rabbit(100350760) gon-4-like (C. elegans)
domestic guinea pig(100734653) gon-4-like (C. elegans)
naked mole-rat(101725287) gon-4-like (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037533 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001003850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001003850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001003850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017710 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203831 MISSION® esiRNA esiRNA targeting mouse Gon4l mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037533 Rosetta Predictions human pricing
NM_032292 Rosetta Predictions human pricing
NM_001024797 Rosetta Predictions rat pricing
NM_001024804 Rosetta Predictions rat pricing
XM_001003850 Rosetta Predictions mouse pricing
XM_001478845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145703 predicted 355
2 SASI_Hs02_00308310 predicted 2894
3 SASI_Hs01_00145705 predicted 988
4 SASI_Hs02_00308311 predicted 1080
5 SASI_Hs01_00145706 predicted 1262
6 SASI_Hs02_00308312 predicted 1101
7 SASI_Hs02_00308313 predicted 473
8 SASI_Hs02_00308314 predicted 4071
9 SASI_Hs02_00308315 predicted 2588
10 SASI_Hs01_00145708 predicted 3582
11 SASI_Hs01_00145704 predicted 2537
12 SASI_Hs01_00145707 predicted 2324
13 SASI_Hs01_00145709 predicted 253
14 SASI_Hs01_00145710 predicted 4166
15 SASI_Hs01_00145711 predicted 2380
16 SASI_Hs01_00145712 predicted 2305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200947 predicted 354
2 SASI_Hs02_00359622 predicted 2892
3 SASI_Hs01_00200949 predicted 987
4 SASI_Hs02_00359623 predicted 1085
5 SASI_Hs01_00200950 predicted 1267
6 SASI_Hs02_00359624 predicted 1097
7 SASI_Hs02_00359625 predicted 466
8 SASI_Hs02_00359626 predicted 4069
9 SASI_Hs02_00359627 predicted 2583
10 SASI_Hs01_00200952 predicted 3576
11 SASI_Hs01_00200948 predicted 2542
12 SASI_Hs01_00200951 predicted 2324
13 SASI_Hs01_00200953 predicted 255
14 SASI_Hs01_00200954 predicted 4167
15 SASI_Hs01_00200955 predicted 2381
16 SASI_Hs01_00200956 predicted 2308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121385 predicted 2223
2 SASI_Rn01_00121387 predicted 2917
3 SASI_Rn02_00202709 predicted 2379
4 SASI_Rn01_00121388 predicted 3033
5 SASI_Rn01_00121390 predicted 1230
6 SASI_Rn01_00121391 predicted 2838
7 SASI_Rn01_00121393 predicted 2774
8 SASI_Rn01_00121394 predicted 1284
9 SASI_Rn02_00202710 predicted 1981
10 SASI_Rn02_00202711 predicted 7042
11 SASI_Rn01_00121386 predicted 2742
12 SASI_Rn01_00121389 predicted 1813
13 SASI_Rn01_00121392 predicted 2148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117145 predicted 5288
2 SASI_Rn01_00117146 predicted 2233
3 SASI_Rn01_00117147 predicted 2741
4 SASI_Rn01_00117148 predicted 2917
5 SASI_Rn01_00117149 predicted 2380
6 SASI_Rn01_00117150 predicted 3042
7 SASI_Rn01_00117151 predicted 1820
8 SASI_Rn01_00117152 predicted 1235
9 SASI_Rn01_00117153 predicted 2850
10 SASI_Rn01_00117154 predicted 2144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356052 predicted 500
2 SASI_Mm02_00356053 predicted 1257
3 SASI_Mm02_00356054 predicted 910
4 SASI_Mm02_00356055 predicted 1087
5 SASI_Mm02_00356056 predicted 489
6 SASI_Mm02_00356057 predicted 665
7 SASI_Mm02_00356058 predicted 464
8 SASI_Mm02_00356059 predicted 1507
9 SASI_Mm02_00356060 predicted 1260
10 SASI_Mm02_00356061 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00405790 predicted 1359
2 SASI_Mm02_00405791 predicted 1675
3 SASI_Mm02_00405792 predicted 1577
4 SASI_Mm02_00405793 predicted 1072
5 SASI_Mm02_00405794 predicted 1767
6 SASI_Mm02_00405795 predicted 1871
7 SASI_Mm02_00405796 predicted 1250
8 SASI_Mm02_00405797 predicted 1865
9 SASI_Mm02_00405798 predicted 1643
10 SASI_Mm02_00405799 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037533
GON4L MISSION shRNA Bacterial Glycerol Stock
gon-4-like (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-128s21c1
Sequence:CCGGGACCTAGAATCAGCCGTTAAACTCGAGTTTAACGGCTGATTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-4963s21c1
Sequence:CCGGGCGAGAAGCCCTACAACATATCTCGAGATATGTTGTAGGGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-1076s21c1
Sequence:CCGGTGGAATATTTCACCAATTAAGCTCGAGCTTAATTGGTGAAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-1304s21c1
Sequence:CCGGGATGAGGAGAGTGGCATATTACTCGAGTAATATGCCACTCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037533.1-7457s21c1
Sequence:CCGGACCTGTAGATGGATGATTATTCTCGAGAATAATCATCCATCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037533
GON4L MISSION shRNA shRNA Plasmid DNA
gon-4-like (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-128s21c1
Sequence:CCGGGACCTAGAATCAGCCGTTAAACTCGAGTTTAACGGCTGATTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-4963s21c1
Sequence:CCGGGCGAGAAGCCCTACAACATATCTCGAGATATGTTGTAGGGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-1076s21c1
Sequence:CCGGTGGAATATTTCACCAATTAAGCTCGAGCTTAATTGGTGAAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-1304s21c1
Sequence:CCGGGATGAGGAGAGTGGCATATTACTCGAGTAATATGCCACTCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037533.1-7457s21c1
Sequence:CCGGACCTGTAGATGGATGATTATTCTCGAGAATAATCATCCATCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037533
GON4L MISSION shRNA Lentiviral Transduction Particles
gon-4-like (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-128s21c1
Sequence:CCGGGACCTAGAATCAGCCGTTAAACTCGAGTTTAACGGCTGATTCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-4963s21c1
Sequence:CCGGGCGAGAAGCCCTACAACATATCTCGAGATATGTTGTAGGGCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-1076s21c1
Sequence:CCGGTGGAATATTTCACCAATTAAGCTCGAGCTTAATTGGTGAAATATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037533.1-1304s21c1
Sequence:CCGGGATGAGGAGAGTGGCATATTACTCGAGTAATATGCCACTCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037533.1-7457s21c1
Sequence:CCGGACCTGTAGATGGATGATTATTCTCGAGAATAATCATCCATCTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001003850
GON4L MISSION shRNA Bacterial Glycerol Stock
gon-4-like (C. elegans)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-467s21c1
Sequence:CCGGCCGGCTTCCATTCTGGTTAAACTCGAGTTTAACCAGAATGGAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-984s21c1
Sequence:CCGGCAGAACCCTGAGTCCAAATTACTCGAGTAATTTGGACTCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-1298s21c1
Sequence:GTACCGGTGAAGATTGCATGGTGGAAATCTCGAGATTTCCACCATGCAATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-1254s21c1
Sequence:CCGGAGCTCTTCATCGAAGGATTTACTCGAGTAAATCCTTCGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-508s21c1
Sequence:CCGGAGGATGAACTGCGGAACATATCTCGAGATATGTTCCGCAGTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001003850
GON4L MISSION shRNA shRNA Plasmid DNA
gon-4-like (C. elegans)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-467s21c1
Sequence:CCGGCCGGCTTCCATTCTGGTTAAACTCGAGTTTAACCAGAATGGAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-984s21c1
Sequence:CCGGCAGAACCCTGAGTCCAAATTACTCGAGTAATTTGGACTCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-1298s21c1
Sequence:GTACCGGTGAAGATTGCATGGTGGAAATCTCGAGATTTCCACCATGCAATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-1254s21c1
Sequence:CCGGAGCTCTTCATCGAAGGATTTACTCGAGTAAATCCTTCGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-508s21c1
Sequence:CCGGAGGATGAACTGCGGAACATATCTCGAGATATGTTCCGCAGTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001003850
GON4L MISSION shRNA Lentiviral Transduction Particles
gon-4-like (C. elegans)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-467s21c1
Sequence:CCGGCCGGCTTCCATTCTGGTTAAACTCGAGTTTAACCAGAATGGAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-984s21c1
Sequence:CCGGCAGAACCCTGAGTCCAAATTACTCGAGTAATTTGGACTCAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-1298s21c1
Sequence:GTACCGGTGAAGATTGCATGGTGGAAATCTCGAGATTTCCACCATGCAATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-1254s21c1
Sequence:CCGGAGCTCTTCATCGAAGGATTTACTCGAGTAAATCCTTCGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001003850.1-508s21c1
Sequence:CCGGAGGATGAACTGCGGAACATATCTCGAGATATGTTCCGCAGTTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017710
GON4L MISSION shRNA Bacterial Glycerol Stock
gon-4-like (C. elegans)
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000180912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1003s1c1
Sequence:CCGGGCAAGGTCTGTGACAGCAAATCTCGAGATTTGCTGTCACAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1895s1c1
Sequence:CCGGGCCACAGACCTTCAACATCATCTCGAGATGATGTTGAAGGTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1655s1c1
Sequence:CCGGCCATGAATCTCCATCAGGAATCTCGAGATTCCTGATGGAGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017710
GON4L MISSION shRNA shRNA Plasmid DNA
gon-4-like (C. elegans)
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000180912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1003s1c1
Sequence:CCGGGCAAGGTCTGTGACAGCAAATCTCGAGATTTGCTGTCACAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1895s1c1
Sequence:CCGGGCCACAGACCTTCAACATCATCTCGAGATGATGTTGAAGGTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1655s1c1
Sequence:CCGGCCATGAATCTCCATCAGGAATCTCGAGATTCCTGATGGAGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017710
GON4L MISSION shRNA Lentiviral Transduction Particles
gon-4-like (C. elegans)
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000180912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1003s1c1
Sequence:CCGGGCAAGGTCTGTGACAGCAAATCTCGAGATTTGCTGTCACAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1895s1c1
Sequence:CCGGGCCACAGACCTTCAACATCATCTCGAGATGATGTTGAAGGTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017710.1-1655s1c1
Sequence:CCGGCCATGAATCTCCATCAGGAATCTCGAGATTCCTGATGGAGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks