EMAIL THIS PAGE TO A FRIEND

GORAB

golgin, RAB6-interacting

100 Gene Product Result for
Synonyms: GO NTKLBP1 SCYL1BP1
UniProtKB ID: Q5T7V8, Q49A22, Q6P1P9, Q9HAE6, Q9Y350
Gene ID:
Human(92344) Summary: This gene encodes a member of the golgin family, a group of coiled-coil proteins localized to the Golgi. The encoded protein may function in the secretory pathway. The encoded protein, which also localizes to the cytoplasm, was identified by interactions with the N-terminal kinase-like protein, and thus it may function in mitosis. Mutations in this gene have been associated with geroderma osteodysplastica. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Mouse(98376) golgin, RAB6-interacting
Rat(304923) golgin, RAB6-interacting
Zebrafish(393356) golgin, rab6-interacting
chicken(770613) golgin, RAB6-interacting
dog(490349) golgin, RAB6-interacting
domestic cat(101088710) golgin, RAB6-interacting
cow(614920) golgin, RAB6-interacting
sheep(101103494) golgin, RAB6-interacting
domestic guinea pig(100717827) golgin, RAB6-interacting
naked mole-rat(101709596) golgin, RAB6-interacting
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152281 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055581 MISSION® esiRNA esiRNA human SCYL1BP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152281 Rosetta Predictions human pricing
XM_001074948 Rosetta Predictions rat pricing
XM_222823 Rosetta Predictions rat pricing
NM_178883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195293 predicted 1222
2 SASI_Hs01_00195294 predicted 718
3 SASI_Hs01_00195296 predicted 474
4 SASI_Hs01_00195297 predicted 698
5 SASI_Hs01_00195298 predicted 335
6 SASI_Hs01_00195299 predicted 397
7 SASI_Hs01_00195300 predicted 541
8 SASI_Hs01_00195301 predicted 200
9 SASI_Hs02_00365818 predicted 773
10 SASI_Hs02_00365819 predicted 498
11 SASI_Hs01_00195295 predicted 1166
12 SASI_Hs01_00195302 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347844 predicted 273
2 SASI_Rn02_00347845 predicted 208
3 SASI_Rn02_00347846 predicted 986
4 SASI_Rn02_00347847 predicted 1211
5 SASI_Rn02_00347848 predicted 1261
6 SASI_Rn02_00347849 predicted 1108
7 SASI_Rn02_00347850 predicted 1269
8 SASI_Rn02_00347851 predicted 763
9 SASI_Rn02_00347852 predicted 378
10 SASI_Rn02_00347853 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380917 predicted 248
2 SASI_Rn02_00380918 predicted 207
3 SASI_Rn02_00380919 predicted 350
4 SASI_Rn02_00380920 predicted 391
5 SASI_Rn02_00380921 predicted 287
6 SASI_Rn02_00380922 predicted 377
7 SASI_Rn02_00380923 predicted 394
8 SASI_Rn02_00380924 predicted 440
9 SASI_Rn02_00380925 predicted 397
10 SASI_Rn02_00380926 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349468 predicted 735
2 SASI_Mm01_00078741 predicted 1179
3 SASI_Mm01_00078742 predicted 1235
4 SASI_Mm01_00078743 predicted 1246
5 SASI_Mm01_00078744 predicted 1240
6 SASI_Mm01_00078745 predicted 1153
7 SASI_Mm01_00078746 predicted 496
8 SASI_Mm01_00078747 predicted 1079
9 SASI_Mm01_00078748 predicted 783
10 SASI_Mm01_00078749 predicted 255
11 SASI_Mm01_00078750 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178883
VALIDATED
GORAB MISSION shRNA Bacterial Glycerol Stock
golgin, RAB6-interacting
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-735s21c1
Sequence:CCGGGAGCTGAAGCTGAGTACATTACTCGAGTAATGTACTCAGCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178883.5-108s21c1
Sequence:CCGGAGCAGAATAAAGATCCATTTGCTCGAGCAAATGGATCTTTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-2020s21c1
Sequence:CCGGTGAAGCATTGAAATCGTTAAACTCGAGTTTAACGATTTCAATGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178883.5-505s21c1
Sequence:CCGGCCAACAAGAACAGCGACTAATCTCGAGATTAGTCGCTGTTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-589s21c1
Sequence:CCGGGACCCAAGCAGAGACCATAAACTCGAGTTTATGGTCTCTGCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-1107s1c1
Sequence:CCGGCATAGACTAGACTGCCCAGATCTCGAGATCTGGGCAGTCTAGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-98s1c1
Sequence:CCGGGAGGAGACTAAAGCAGAATAACTCGAGTTATTCTGCTTTAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-444s1c1
Sequence:CCGGCCAGATTGCAAAGTGGAGAAACTCGAGTTTCTCCACTTTGCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178883
VALIDATED
GORAB MISSION shRNA shRNA Plasmid DNA
golgin, RAB6-interacting
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-735s21c1
Sequence:CCGGGAGCTGAAGCTGAGTACATTACTCGAGTAATGTACTCAGCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178883.5-108s21c1
Sequence:CCGGAGCAGAATAAAGATCCATTTGCTCGAGCAAATGGATCTTTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-2020s21c1
Sequence:CCGGTGAAGCATTGAAATCGTTAAACTCGAGTTTAACGATTTCAATGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178883.5-505s21c1
Sequence:CCGGCCAACAAGAACAGCGACTAATCTCGAGATTAGTCGCTGTTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-589s21c1
Sequence:CCGGGACCCAAGCAGAGACCATAAACTCGAGTTTATGGTCTCTGCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-1107s1c1
Sequence:CCGGCATAGACTAGACTGCCCAGATCTCGAGATCTGGGCAGTCTAGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-98s1c1
Sequence:CCGGGAGGAGACTAAAGCAGAATAACTCGAGTTATTCTGCTTTAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-444s1c1
Sequence:CCGGCCAGATTGCAAAGTGGAGAAACTCGAGTTTCTCCACTTTGCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178883
VALIDATED
GORAB MISSION shRNA Lentiviral Transduction Particles
golgin, RAB6-interacting
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-735s21c1
Sequence:CCGGGAGCTGAAGCTGAGTACATTACTCGAGTAATGTACTCAGCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178883.5-108s21c1
Sequence:CCGGAGCAGAATAAAGATCCATTTGCTCGAGCAAATGGATCTTTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-2020s21c1
Sequence:CCGGTGAAGCATTGAAATCGTTAAACTCGAGTTTAACGATTTCAATGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178883.5-505s21c1
Sequence:CCGGCCAACAAGAACAGCGACTAATCTCGAGATTAGTCGCTGTTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178883.5-589s21c1
Sequence:CCGGGACCCAAGCAGAGACCATAAACTCGAGTTTATGGTCTCTGCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-1107s1c1
Sequence:CCGGCATAGACTAGACTGCCCAGATCTCGAGATCTGGGCAGTCTAGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-98s1c1
Sequence:CCGGGAGGAGACTAAAGCAGAATAACTCGAGTTATTCTGCTTTAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178883.3-444s1c1
Sequence:CCGGCCAGATTGCAAAGTGGAGAAACTCGAGTTTCTCCACTTTGCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152281
GORAB MISSION shRNA Bacterial Glycerol Stock
golgin, RAB6-interacting
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-1008s1c1
Sequence:CCGGGTTCGTTTAGAGAGGCCATTTCTCGAGAAATGGCCTCTCTAAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-552s1c1
Sequence:CCGGCAACGGCTAATGGAAGAGAAACTCGAGTTTCTCTTCCATTAGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152281.1-352s1c1
Sequence:CCGGCGAGTCATTTCACTCTCACCTCTCGAGAGGTGAGAGTGAAATGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152281.1-1416s1c1
Sequence:CCGGCGGTTCTTTCAGTGTTCCGTTCTCGAGAACGGAACACTGAAAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-480s1c1
Sequence:CCGGCCAGATTGCAAATTGGAGAAACTCGAGTTTCTCCAATTTGCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152281.1-1757s1c1
Sequence:CCGGCCAAACAACTTAAACCAGCATCTCGAGATGCTGGTTTAAGTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152281.1-1790s1c1
Sequence:CCGGCAATTTGCCTTCCAGTGATTTCTCGAGAAATCACTGGAAGGCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152281.1-849s1c1
Sequence:CCGGCTTTGTACGATCATACAGCAACTCGAGTTGCTGTATGATCGTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152281.1-1418s1c1
Sequence:CCGGGTTCTTTCAGTGTTCCGTTTACTCGAGTAAACGGAACACTGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152281
GORAB MISSION shRNA shRNA Plasmid DNA
golgin, RAB6-interacting
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-1008s1c1
Sequence:CCGGGTTCGTTTAGAGAGGCCATTTCTCGAGAAATGGCCTCTCTAAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-552s1c1
Sequence:CCGGCAACGGCTAATGGAAGAGAAACTCGAGTTTCTCTTCCATTAGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152281.1-352s1c1
Sequence:CCGGCGAGTCATTTCACTCTCACCTCTCGAGAGGTGAGAGTGAAATGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152281.1-1416s1c1
Sequence:CCGGCGGTTCTTTCAGTGTTCCGTTCTCGAGAACGGAACACTGAAAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-480s1c1
Sequence:CCGGCCAGATTGCAAATTGGAGAAACTCGAGTTTCTCCAATTTGCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152281.1-1757s1c1
Sequence:CCGGCCAAACAACTTAAACCAGCATCTCGAGATGCTGGTTTAAGTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152281.1-1790s1c1
Sequence:CCGGCAATTTGCCTTCCAGTGATTTCTCGAGAAATCACTGGAAGGCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152281.1-849s1c1
Sequence:CCGGCTTTGTACGATCATACAGCAACTCGAGTTGCTGTATGATCGTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152281.1-1418s1c1
Sequence:CCGGGTTCTTTCAGTGTTCCGTTTACTCGAGTAAACGGAACACTGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152281
GORAB MISSION shRNA Lentiviral Transduction Particles
golgin, RAB6-interacting
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-1008s1c1
Sequence:CCGGGTTCGTTTAGAGAGGCCATTTCTCGAGAAATGGCCTCTCTAAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-552s1c1
Sequence:CCGGCAACGGCTAATGGAAGAGAAACTCGAGTTTCTCTTCCATTAGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152281.1-352s1c1
Sequence:CCGGCGAGTCATTTCACTCTCACCTCTCGAGAGGTGAGAGTGAAATGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152281.1-1416s1c1
Sequence:CCGGCGGTTCTTTCAGTGTTCCGTTCTCGAGAACGGAACACTGAAAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152281.1-480s1c1
Sequence:CCGGCCAGATTGCAAATTGGAGAAACTCGAGTTTCTCCAATTTGCAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121741    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152281.1-1757s1c1
Sequence:CCGGCCAAACAACTTAAACCAGCATCTCGAGATGCTGGTTTAAGTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145611    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152281.1-1790s1c1
Sequence:CCGGCAATTTGCCTTCCAGTGATTTCTCGAGAAATCACTGGAAGGCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152281.1-849s1c1
Sequence:CCGGCTTTGTACGATCATACAGCAACTCGAGTTGCTGTATGATCGTACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152281.1-1418s1c1
Sequence:CCGGGTTCTTTCAGTGTTCCGTTTACTCGAGTAAACGGAACACTGAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks