EMAIL THIS PAGE TO A FRIEND

GORASP1

golgi reassembly stacking protein 1, 65kDa

58 Gene Product Result for
Synonyms: GOLPH5 GRASP65 P65
UniProtKB ID: Q9BQQ3, B3KWC8, Q3SYG7, Q8N272, Q96H42
Gene ID:
Human(64689) Summary: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a membrane protein involved in establishing the stacked structure of the Golgi apparatus. It is a caspase-3 substrate, and cleavage of this encoded protein contributes to Golgi fragmentation in apoptosis. This encoded protein can form a complex with the Golgi matrix protein GOLGA2, and this complex binds to the vesicle docking protein p115. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(74498) golgi reassembly stacking protein 1
Rat(56082) golgi reassembly stacking protein 1
domestic guinea pig(100735064) golgi reassembly stacking protein 1, 65kDa
naked mole-rat(101708689) golgi reassembly stacking protein 1, 65kDa
sheep(101117540) golgi reassembly stacking protein 1, 65kDa
Zebrafish(492770) golgi reassembly stacking protein 1
chicken(420426) golgi reassembly stacking protein 1, 65kDa
dog(485594) golgi reassembly stacking protein 1, 65kDa
cow(613757) golgi reassembly stacking protein 1, 65kDa
domestic cat(101085067) golgi reassembly stacking protein 1, 65kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031899 Rosetta Predictions human pricing
NM_019385 Rosetta Predictions rat pricing
NM_028976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155330 predicted 258
2 SASI_Hs02_00359017 predicted 241
3 SASI_Hs02_00359018 predicted 1793
4 SASI_Hs01_00155331 predicted 1426
5 SASI_Hs01_00155332 predicted 1396
6 SASI_Hs01_00155333 predicted 1168
7 SASI_Hs01_00155334 predicted 825
8 SASI_Hs01_00155336 predicted 1864
9 SASI_Hs01_00155337 predicted 1505
10 SASI_Hs02_00359019 predicted 297
11 SASI_Hs01_00155329 predicted 294
12 SASI_Hs01_00155335 predicted 664
13 SASI_Hs01_00155338 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122247 predicted 1434
2 SASI_Rn01_00122248 predicted 757
3 SASI_Rn01_00122249 predicted 1685
4 SASI_Rn01_00122250 predicted 439
5 SASI_Rn01_00122251 predicted 1496
6 SASI_Rn01_00122252 predicted 1466
7 SASI_Rn01_00122253 predicted 1104
8 SASI_Rn01_00122254 predicted 453
9 SASI_Rn01_00122255 predicted 1394
10 SASI_Rn01_00122256 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161960 predicted 1077
2 SASI_Mm01_00161961 predicted 468
3 SASI_Mm01_00161962 predicted 825
4 SASI_Mm01_00161963 predicted 1139
5 SASI_Mm02_00334704 predicted 467
6 SASI_Mm01_00161964 predicted 1670
7 SASI_Mm01_00161965 predicted 606
8 SASI_Mm02_00334705 predicted 1437
9 SASI_Mm01_00161967 predicted 1672
10 SASI_Mm01_00161968 predicted 1537
11 SASI_Mm01_00161966 predicted 1628
12 SASI_Mm01_00161969 predicted 1444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031899
VALIDATED
GORASP1 MISSION shRNA Bacterial Glycerol Stock
golgi reassembly stacking protein 1, 65kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031899.2-1942s1c1
Sequence:CCGGCGTTGGAAATTCTAGGCCCTTCTCGAGAAGGGCCTAGAATTTCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031899.2-2590s1c1
Sequence:CCGGCCAAATTAGCAAACCCTTCATCTCGAGATGAAGGGTTTGCTAATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-584s1c1
Sequence:CCGGGCTGATGGTGTATAACTCCAACTCGAGTTGGAGTTATACACCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-2453s1c1
Sequence:CCGGCCTAGTTGAAAGTCTCACCTTCTCGAGAAGGTGAGACTTTCAACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-1187s1c1
Sequence:CCGGGTCAGAGTTTGAGGTCTCCTTCTCGAGAAGGAGACCTCAAACTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031899.2-683s1c1
Sequence:CCGGCTATGGGTATCTACACCGGATCTCGAGATCCGGTGTAGATACCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-536s1c1
Sequence:CCGGCGAGGACTTCTTTACGCTCATCTCGAGATGAGCGTAAAGAAGTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031899.2-297s1c1
Sequence:CCGGGTGAAGCTGGAGGTGTTCAATCTCGAGATTGAACACCTCCAGCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-1025s1c1
Sequence:CCGGCGTGTCGGGAATTTCTCTCTTCTCGAGAAGAGAGAAATTCCCGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-2710s1c1
Sequence:CCGGGCTGGAATGCAGGAAGTAGAACTCGAGTTCTACTTCCTGCATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031899
VALIDATED
GORASP1 MISSION shRNA shRNA Plasmid DNA
golgi reassembly stacking protein 1, 65kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031899.2-1942s1c1
Sequence:CCGGCGTTGGAAATTCTAGGCCCTTCTCGAGAAGGGCCTAGAATTTCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031899.2-2590s1c1
Sequence:CCGGCCAAATTAGCAAACCCTTCATCTCGAGATGAAGGGTTTGCTAATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-584s1c1
Sequence:CCGGGCTGATGGTGTATAACTCCAACTCGAGTTGGAGTTATACACCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-2453s1c1
Sequence:CCGGCCTAGTTGAAAGTCTCACCTTCTCGAGAAGGTGAGACTTTCAACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-1187s1c1
Sequence:CCGGGTCAGAGTTTGAGGTCTCCTTCTCGAGAAGGAGACCTCAAACTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031899.2-683s1c1
Sequence:CCGGCTATGGGTATCTACACCGGATCTCGAGATCCGGTGTAGATACCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-536s1c1
Sequence:CCGGCGAGGACTTCTTTACGCTCATCTCGAGATGAGCGTAAAGAAGTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031899.2-297s1c1
Sequence:CCGGGTGAAGCTGGAGGTGTTCAATCTCGAGATTGAACACCTCCAGCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-1025s1c1
Sequence:CCGGCGTGTCGGGAATTTCTCTCTTCTCGAGAAGAGAGAAATTCCCGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-2710s1c1
Sequence:CCGGGCTGGAATGCAGGAAGTAGAACTCGAGTTCTACTTCCTGCATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031899
VALIDATED
GORASP1 MISSION shRNA Lentiviral Transduction Particles
golgi reassembly stacking protein 1, 65kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031899.2-1942s1c1
Sequence:CCGGCGTTGGAAATTCTAGGCCCTTCTCGAGAAGGGCCTAGAATTTCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031899.2-2590s1c1
Sequence:CCGGCCAAATTAGCAAACCCTTCATCTCGAGATGAAGGGTTTGCTAATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-584s1c1
Sequence:CCGGGCTGATGGTGTATAACTCCAACTCGAGTTGGAGTTATACACCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-2453s1c1
Sequence:CCGGCCTAGTTGAAAGTCTCACCTTCTCGAGAAGGTGAGACTTTCAACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-1187s1c1
Sequence:CCGGGTCAGAGTTTGAGGTCTCCTTCTCGAGAAGGAGACCTCAAACTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031899.2-683s1c1
Sequence:CCGGCTATGGGTATCTACACCGGATCTCGAGATCCGGTGTAGATACCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-536s1c1
Sequence:CCGGCGAGGACTTCTTTACGCTCATCTCGAGATGAGCGTAAAGAAGTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031899.2-297s1c1
Sequence:CCGGGTGAAGCTGGAGGTGTTCAATCTCGAGATTGAACACCTCCAGCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_031899.2-1025s1c1
Sequence:CCGGCGTGTCGGGAATTTCTCTCTTCTCGAGAAGAGAGAAATTCCCGACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_031899.2-2710s1c1
Sequence:CCGGGCTGGAATGCAGGAAGTAGAACTCGAGTTCTACTTCCTGCATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028976
VALIDATED
GORASP1 MISSION shRNA Bacterial Glycerol Stock
golgi reassembly stacking protein 1, 65kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-2125s1c1
Sequence:CCGGCCAGCCTCTTTGTTCCATCATCTCGAGATGATGGAACAAAGAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-711s1c1
Sequence:CCGGACCTCACAACTTACTGCCTTTCTCGAGAAAGGCAGTAAGTTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-1078s1c1
Sequence:CCGGCAGAGGACATTGGTTCTAGCACTCGAGTGCTAGAACCAATGTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028976.1-909s1c1
Sequence:CCGGCGTGCTATGGAGATCCCGCTTCTCGAGAAGCGGGATCTCCATAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-429s1c1
Sequence:CCGGCCTTACACAGACTACATAGTTCTCGAGAACTATGTAGTCTGTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-517s21c1
Sequence:CCGGCTCTGAAGCTGATGGTGTATACTCGAGTATACACCATCAGCTTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028976.2-2125s21c1
Sequence:CCGGCCAGCCTCTTTGTTCCATCATCTCGAGATGATGGAACAAAGAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-711s21c1
Sequence:CCGGACCTCACAACTTACTGCCTTTCTCGAGAAAGGCAGTAAGTTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-429s21c1
Sequence:CCGGCCTTACACAGACTACATAGTTCTCGAGAACTATGTAGTCTGTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-823s21c1
Sequence:CCGGCACAAGTCCCTGGTAGCTTTACTCGAGTAAAGCTACCAGGGACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028976
VALIDATED
GORASP1 MISSION shRNA shRNA Plasmid DNA
golgi reassembly stacking protein 1, 65kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-2125s1c1
Sequence:CCGGCCAGCCTCTTTGTTCCATCATCTCGAGATGATGGAACAAAGAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-711s1c1
Sequence:CCGGACCTCACAACTTACTGCCTTTCTCGAGAAAGGCAGTAAGTTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-1078s1c1
Sequence:CCGGCAGAGGACATTGGTTCTAGCACTCGAGTGCTAGAACCAATGTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028976.1-909s1c1
Sequence:CCGGCGTGCTATGGAGATCCCGCTTCTCGAGAAGCGGGATCTCCATAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-429s1c1
Sequence:CCGGCCTTACACAGACTACATAGTTCTCGAGAACTATGTAGTCTGTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-517s21c1
Sequence:CCGGCTCTGAAGCTGATGGTGTATACTCGAGTATACACCATCAGCTTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028976.2-2125s21c1
Sequence:CCGGCCAGCCTCTTTGTTCCATCATCTCGAGATGATGGAACAAAGAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-711s21c1
Sequence:CCGGACCTCACAACTTACTGCCTTTCTCGAGAAAGGCAGTAAGTTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-429s21c1
Sequence:CCGGCCTTACACAGACTACATAGTTCTCGAGAACTATGTAGTCTGTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-823s21c1
Sequence:CCGGCACAAGTCCCTGGTAGCTTTACTCGAGTAAAGCTACCAGGGACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028976
VALIDATED
GORASP1 MISSION shRNA Lentiviral Transduction Particles
golgi reassembly stacking protein 1, 65kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-2125s1c1
Sequence:CCGGCCAGCCTCTTTGTTCCATCATCTCGAGATGATGGAACAAAGAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-711s1c1
Sequence:CCGGACCTCACAACTTACTGCCTTTCTCGAGAAAGGCAGTAAGTTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-1078s1c1
Sequence:CCGGCAGAGGACATTGGTTCTAGCACTCGAGTGCTAGAACCAATGTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028976.1-909s1c1
Sequence:CCGGCGTGCTATGGAGATCCCGCTTCTCGAGAAGCGGGATCTCCATAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028976.1-429s1c1
Sequence:CCGGCCTTACACAGACTACATAGTTCTCGAGAACTATGTAGTCTGTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-517s21c1
Sequence:CCGGCTCTGAAGCTGATGGTGTATACTCGAGTATACACCATCAGCTTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028976.2-2125s21c1
Sequence:CCGGCCAGCCTCTTTGTTCCATCATCTCGAGATGATGGAACAAAGAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-711s21c1
Sequence:CCGGACCTCACAACTTACTGCCTTTCTCGAGAAAGGCAGTAAGTTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-429s21c1
Sequence:CCGGCCTTACACAGACTACATAGTTCTCGAGAACTATGTAGTCTGTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028976.2-823s21c1
Sequence:CCGGCACAAGTCCCTGGTAGCTTTACTCGAGTAAAGCTACCAGGGACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)