EMAIL THIS PAGE TO A FRIEND

GORASP2

golgi reassembly stacking protein 2, 55kDa

153 Gene Product Result for
Synonyms: GOLPH6 GRASP55 GRS2 p59
UniProtKB ID: Q9H8Y8, Q53TE3, Q96I74, Q96K84, Q9H946, Q9UFW4
Gene ID:
Human(26003) Summary: This gene encodes a member of the Golgi reassembly stacking protein family. These proteins may play a role in the stacking of Golgi cisternae and Golgi ribbon formation, as well as Golgi fragmentation during apoptosis or mitosis. The encoded protein also plays a role in the intracellular transport of transforming growth factor alpha and may function as a molecular chaperone. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(70231) golgi reassembly stacking protein 2
Rat(113961) golgi reassembly stacking protein 2
Zebrafish(393676) golgi reassembly stacking protein 2
cow(513771) golgi reassembly stacking protein 2, 55kDa
Horse(100052914) golgi reassembly stacking protein 2, 55kDa
domestic cat(101088506) golgi reassembly stacking protein 2, 55kDa
dog(488395) golgi reassembly stacking protein 2, 55kDa
chicken(424156) golgi reassembly stacking protein 2, 55kDa
sheep(101117138) golgi reassembly stacking protein 2, 55kDa
domestic guinea pig(100726705) golgi reassembly stacking protein 2, 55kDa
naked mole-rat(101696677) golgi reassembly stacking protein 2, 55kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015530 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015530 Rosetta Predictions human pricing
NM_001007720 Rosetta Predictions rat pricing
NM_027352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012371 predicted 531
2 SASI_Hs02_00348040 predicted 949
3 SASI_Hs01_00012374 predicted 584
4 SASI_Hs02_00348041 predicted 1564
5 SASI_Hs01_00012375 predicted 645
6 SASI_Hs01_00012376 predicted 1327
7 SASI_Hs01_00012377 predicted 1487
8 SASI_Hs01_00012378 predicted 613
9 SASI_Hs01_00012379 predicted 1513
10 SASI_Hs01_00012380 predicted 783
11 SASI_Hs01_00012372 predicted 337
12 SASI_Hs01_00012373 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121194 predicted 1460
2 SASI_Rn01_00121195 predicted 611
3 SASI_Rn01_00121196 predicted 499
4 SASI_Rn01_00121197 predicted 477
5 SASI_Rn01_00121198 predicted 1405
6 SASI_Rn01_00121199 predicted 1435
7 SASI_Rn02_00198901 predicted 489
8 SASI_Rn01_00121201 predicted 1134
9 SASI_Rn01_00121202 predicted 620
10 SASI_Rn01_00121203 predicted 836
11 SASI_Rn01_00121200 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121711 predicted 1549
2 SASI_Mm01_00121712 predicted 698
3 SASI_Mm01_00121713 predicted 955
4 SASI_Mm01_00121714 predicted 498
5 SASI_Mm01_00121716 predicted 646
6 SASI_Mm01_00121717 predicted 1540
7 SASI_Mm01_00121718 predicted 855
8 SASI_Mm01_00121719 predicted 686
9 SASI_Mm01_00121720 predicted 785
10 SASI_Mm02_00332019 predicted 1226
11 SASI_Mm01_00121715 predicted 940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027352
VALIDATED
GORASP2 MISSION shRNA Bacterial Glycerol Stock
golgi reassembly stacking protein 2, 55kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-1056s21c1
Sequence:CCGGCCTTGCTTCTATGCCACCAATCTCGAGATTGGTGGCATAGAAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-773s21c1
Sequence:CCGGGCTATGGTTATTTGCACCGAACTCGAGTTCGGTGCAAATAACCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027352.4-1886s21c1
Sequence:CCGGGCCTTGTGTAAGGAAATGAAACTCGAGTTTCATTTCCTTACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-1386s21c1
Sequence:CCGGCCCTGTCATGACTACTGCAAACTCGAGTTTGCAGTAGTCATGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-1821s1c1
Sequence:CCGGGCCTTGTGTAAGGAAATGAAACTCGAGTTTCATTTCCTTACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027352.2-990s1c1
Sequence:CCGGCCTTGCTTCTATGCCACCAATCTCGAGATTGGTGGCATAGAAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-707s1c1
Sequence:CCGGGCTATGGTTATTTGCACCGAACTCGAGTTCGGTGCAAATAACCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-973s1c1
Sequence:CCGGCCACAAGTAAACCAGTCCCTTCTCGAGAAGGGACTGGTTTACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-1320s1c1
Sequence:CCGGCCCTGTCATGACTACTGCAAACTCGAGTTTGCAGTAGTCATGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027352
VALIDATED
GORASP2 MISSION shRNA shRNA Plasmid DNA
golgi reassembly stacking protein 2, 55kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-1056s21c1
Sequence:CCGGCCTTGCTTCTATGCCACCAATCTCGAGATTGGTGGCATAGAAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-773s21c1
Sequence:CCGGGCTATGGTTATTTGCACCGAACTCGAGTTCGGTGCAAATAACCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027352.4-1886s21c1
Sequence:CCGGGCCTTGTGTAAGGAAATGAAACTCGAGTTTCATTTCCTTACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-1386s21c1
Sequence:CCGGCCCTGTCATGACTACTGCAAACTCGAGTTTGCAGTAGTCATGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-1821s1c1
Sequence:CCGGGCCTTGTGTAAGGAAATGAAACTCGAGTTTCATTTCCTTACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027352.2-990s1c1
Sequence:CCGGCCTTGCTTCTATGCCACCAATCTCGAGATTGGTGGCATAGAAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-707s1c1
Sequence:CCGGGCTATGGTTATTTGCACCGAACTCGAGTTCGGTGCAAATAACCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-973s1c1
Sequence:CCGGCCACAAGTAAACCAGTCCCTTCTCGAGAAGGGACTGGTTTACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-1320s1c1
Sequence:CCGGCCCTGTCATGACTACTGCAAACTCGAGTTTGCAGTAGTCATGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027352
VALIDATED
GORASP2 MISSION shRNA Lentiviral Transduction Particles
golgi reassembly stacking protein 2, 55kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-1056s21c1
Sequence:CCGGCCTTGCTTCTATGCCACCAATCTCGAGATTGGTGGCATAGAAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-773s21c1
Sequence:CCGGGCTATGGTTATTTGCACCGAACTCGAGTTCGGTGCAAATAACCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027352.4-1886s21c1
Sequence:CCGGGCCTTGTGTAAGGAAATGAAACTCGAGTTTCATTTCCTTACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027352.4-1386s21c1
Sequence:CCGGCCCTGTCATGACTACTGCAAACTCGAGTTTGCAGTAGTCATGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-1821s1c1
Sequence:CCGGGCCTTGTGTAAGGAAATGAAACTCGAGTTTCATTTCCTTACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027352.2-990s1c1
Sequence:CCGGCCTTGCTTCTATGCCACCAATCTCGAGATTGGTGGCATAGAAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-707s1c1
Sequence:CCGGGCTATGGTTATTTGCACCGAACTCGAGTTCGGTGCAAATAACCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-973s1c1
Sequence:CCGGCCACAAGTAAACCAGTCCCTTCTCGAGAAGGGACTGGTTTACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027352.2-1320s1c1
Sequence:CCGGCCCTGTCATGACTACTGCAAACTCGAGTTTGCAGTAGTCATGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015530
VALIDATED
GORASP2 MISSION shRNA Bacterial Glycerol Stock
golgi reassembly stacking protein 2, 55kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-383s21c1
Sequence:CCGGGACCTCAGTCACACCAAGTAACTCGAGTTACTTGGTGTGACTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-1867s21c1
Sequence:CCGGCCTAATACTCACACGCAACATCTCGAGATGTTGCGTGTGAGTATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-309s21c1
Sequence:CCGGGATCTGCTGAAAGCAAACGTTCTCGAGAACGTTTGCTTTCAGCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-741s21c1
Sequence:CCGGCGAATACCTACACGCCCATTTCTCGAGAAATGGGCGTGTAGGTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-2043s21c1
Sequence:CCGGGCACTGTTAACTGAACGTCTTCTCGAGAAGACGTTCAGTTAACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-2043s1c1
Sequence:CCGGGCACTGTTAACTGAACGTCTTCTCGAGAAGACGTTCAGTTAACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015530.3-383s1c1
Sequence:CCGGGACCTCAGTCACACCAAGTAACTCGAGTTACTTGGTGTGACTGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015530.3-2131s1c1
Sequence:CCGGGCTGCTGTTGCTTTCTACATACTCGAGTATGTAGAAAGCAACAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-741s1c1
Sequence:CCGGCGAATACCTACACGCCCATTTCTCGAGAAATGGGCGTGTAGGTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-309s1c1
Sequence:CCGGGATCTGCTGAAAGCAAACGTTCTCGAGAACGTTTGCTTTCAGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015530.3-2009s1c1
Sequence:CCGGCCACCTGAAGACTTGTGTTAACTCGAGTTAACACAAGTCTTCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-1867s1c1
Sequence:CCGGCCTAATACTCACACGCAACATCTCGAGATGTTGCGTGTGAGTATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015530.3-1024s1c1
Sequence:CCGGCAATGAATCCAGCTACTACATCTCGAGATGTAGTAGCTGGATTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015530
VALIDATED
GORASP2 MISSION shRNA shRNA Plasmid DNA
golgi reassembly stacking protein 2, 55kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-383s21c1
Sequence:CCGGGACCTCAGTCACACCAAGTAACTCGAGTTACTTGGTGTGACTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-1867s21c1
Sequence:CCGGCCTAATACTCACACGCAACATCTCGAGATGTTGCGTGTGAGTATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-309s21c1
Sequence:CCGGGATCTGCTGAAAGCAAACGTTCTCGAGAACGTTTGCTTTCAGCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-741s21c1
Sequence:CCGGCGAATACCTACACGCCCATTTCTCGAGAAATGGGCGTGTAGGTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-2043s21c1
Sequence:CCGGGCACTGTTAACTGAACGTCTTCTCGAGAAGACGTTCAGTTAACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-2043s1c1
Sequence:CCGGGCACTGTTAACTGAACGTCTTCTCGAGAAGACGTTCAGTTAACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015530.3-383s1c1
Sequence:CCGGGACCTCAGTCACACCAAGTAACTCGAGTTACTTGGTGTGACTGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015530.3-2131s1c1
Sequence:CCGGGCTGCTGTTGCTTTCTACATACTCGAGTATGTAGAAAGCAACAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-741s1c1
Sequence:CCGGCGAATACCTACACGCCCATTTCTCGAGAAATGGGCGTGTAGGTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-309s1c1
Sequence:CCGGGATCTGCTGAAAGCAAACGTTCTCGAGAACGTTTGCTTTCAGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015530.3-2009s1c1
Sequence:CCGGCCACCTGAAGACTTGTGTTAACTCGAGTTAACACAAGTCTTCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-1867s1c1
Sequence:CCGGCCTAATACTCACACGCAACATCTCGAGATGTTGCGTGTGAGTATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015530.3-1024s1c1
Sequence:CCGGCAATGAATCCAGCTACTACATCTCGAGATGTAGTAGCTGGATTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015530
VALIDATED
GORASP2 MISSION shRNA Lentiviral Transduction Particles
golgi reassembly stacking protein 2, 55kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-383s21c1
Sequence:CCGGGACCTCAGTCACACCAAGTAACTCGAGTTACTTGGTGTGACTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-1867s21c1
Sequence:CCGGCCTAATACTCACACGCAACATCTCGAGATGTTGCGTGTGAGTATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-309s21c1
Sequence:CCGGGATCTGCTGAAAGCAAACGTTCTCGAGAACGTTTGCTTTCAGCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-741s21c1
Sequence:CCGGCGAATACCTACACGCCCATTTCTCGAGAAATGGGCGTGTAGGTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015530.3-2043s21c1
Sequence:CCGGGCACTGTTAACTGAACGTCTTCTCGAGAAGACGTTCAGTTAACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-2043s1c1
Sequence:CCGGGCACTGTTAACTGAACGTCTTCTCGAGAAGACGTTCAGTTAACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015530.3-383s1c1
Sequence:CCGGGACCTCAGTCACACCAAGTAACTCGAGTTACTTGGTGTGACTGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015530.3-2131s1c1
Sequence:CCGGGCTGCTGTTGCTTTCTACATACTCGAGTATGTAGAAAGCAACAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-741s1c1
Sequence:CCGGCGAATACCTACACGCCCATTTCTCGAGAAATGGGCGTGTAGGTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-309s1c1
Sequence:CCGGGATCTGCTGAAAGCAAACGTTCTCGAGAACGTTTGCTTTCAGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015530.3-2009s1c1
Sequence:CCGGCCACCTGAAGACTTGTGTTAACTCGAGTTAACACAAGTCTTCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015530.3-1867s1c1
Sequence:CCGGCCTAATACTCACACGCAACATCTCGAGATGTTGCGTGTGAGTATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015530.3-1024s1c1
Sequence:CCGGCAATGAATCCAGCTACTACATCTCGAGATGTAGTAGCTGGATTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)