EMAIL THIS PAGE TO A FRIEND

GOSR1

golgi SNAP receptor complex member 1

221 Gene Product Result for
Synonyms: GOLIM2 GOS-28 GOS28 GOS28/P28 GS28 P28
UniProtKB ID: O95249, J3KST5, O75392
Gene ID:
Human(9527) Summary: This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(53334) golgi SNAP receptor complex member 1
Rat(94189) golgi SNAP receptor complex member 1
Zebrafish(100001316) golgi SNAP receptor complex member 1
domestic cat(101090219) golgi SNAP receptor complex member 1
cow(511030) golgi SNAP receptor complex member 1
dog(491185) golgi SNAP receptor complex member 1
chicken(417591) golgi SNAP receptor complex member 1
domestic guinea pig(100716724) golgi SNAP receptor complex member 1
naked mole-rat(101707885) golgi SNAP receptor complex member 1
sheep(101112332) golgi SNAP receptor complex member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007024 Rosetta Predictions human pricing
NM_001007025 Rosetta Predictions human pricing
NM_004871 Rosetta Predictions human pricing
NM_053584 Rosetta Predictions rat pricing
NM_016810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027596 predicted 426
2 SASI_Hs01_00027597 predicted 623
3 SASI_Hs01_00027598 predicted 632
4 SASI_Hs01_00027599 predicted 771
5 SASI_Hs01_00027600 predicted 445
6 SASI_Hs01_00027601 predicted 550
7 SASI_Hs02_00305177 predicted 617
8 SASI_Hs01_00027602 predicted 505
9 SASI_Hs01_00027603 predicted 414
10 SASI_Hs01_00027604 predicted 429
11 SASI_Hs01_00027605 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230630 predicted 410
2 SASI_Hs01_00230631 predicted 592
3 SASI_Hs01_00230632 predicted 609
4 SASI_Hs01_00230633 predicted 750
5 SASI_Hs01_00230634 predicted 423
6 SASI_Hs01_00230635 predicted 531
7 SASI_Hs02_00305178 predicted 590
8 SASI_Hs01_00230636 predicted 484
9 SASI_Hs01_00230637 predicted 385
10 SASI_Hs01_00230638 predicted 415
11 SASI_Hs01_00230639 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068027 predicted 411
2 SASI_Hs01_00068028 predicted 607
3 SASI_Hs01_00068029 predicted 615
4 SASI_Hs01_00068030 predicted 754
5 SASI_Hs01_00068031 predicted 428
6 SASI_Hs01_00068032 predicted 535
7 SASI_Hs02_00338500 predicted 596
8 SASI_Hs01_00068033 predicted 489
9 SASI_Hs01_00068034 predicted 391
10 SASI_Hs01_00068035 predicted 415
11 SASI_Hs01_00068036 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108016 predicted 1122
2 SASI_Rn01_00108017 predicted 556
3 SASI_Rn01_00108018 predicted 1196
4 SASI_Rn01_00108020 predicted 634
5 SASI_Rn01_00108021 predicted 200
6 SASI_Rn01_00108022 predicted 233
7 SASI_Rn02_00266252 predicted 1056
8 SASI_Rn01_00108023 predicted 1203
9 SASI_Rn02_00266253 predicted 507
10 SASI_Rn02_00266254 predicted 1103
11 SASI_Rn01_00108015 predicted 396
12 SASI_Rn01_00108019 predicted 209
13 SASI_Rn01_00108024 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144976 predicted 560
2 SASI_Mm01_00144977 predicted 517
3 SASI_Mm01_00144978 predicted 212
4 SASI_Mm01_00144979 predicted 340
5 SASI_Mm01_00144980 predicted 242
6 SASI_Mm01_00144981 predicted 348
7 SASI_Mm01_00144982 predicted 732
8 SASI_Mm01_00144983 predicted 1125
9 SASI_Mm01_00144984 predicted 1103
10 SASI_Mm01_00144985 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016810
VALIDATED
GOSR1 MISSION shRNA Bacterial Glycerol Stock
golgi SNAP receptor complex member 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016810.2-1128s1c1
Sequence:CCGGGCCACGAGATTGGATGTGAATCTCGAGATTCACATCCAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-516s1c1
Sequence:CCGGCGAAACTCTGATCGTCTGATACTCGAGTATCAGACGATCAGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-596s1c1
Sequence:CCGGGCTCAAGTCAATTCACAGCAACTCGAGTTGCTGTGAATTGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-351s1c1
Sequence:CCGGCAGGATTATACACACGAATTTCTCGAGAAATTCGTGTGTATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-350s1c1
Sequence:CCGGGCAGGATTATACACACGAATTCTCGAGAATTCGTGTGTATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-160s21c1
Sequence:CCGGCTGACACAACACCGCTATTAACTCGAGTTAATAGCGGTGTTGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-647s21c1
Sequence:CCGGCGTGAACAGCCTGATACAAAGCTCGAGCTTTGTATCAGGCTGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-1128s21c1
Sequence:CCGGGCCACGAGATTGGATGTGAATCTCGAGATTCACATCCAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-516s21c1
Sequence:CCGGCGAAACTCTGATCGTCTGATACTCGAGTATCAGACGATCAGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-351s21c1
Sequence:CCGGCAGGATTATACACACGAATTTCTCGAGAAATTCGTGTGTATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016810.3-433s21c1
Sequence:GTACCGGGGAAAGATATTGAGTCATATACTCGAGTATATGACTCAATATCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016810.3-588s21c1
Sequence:GTACCGGAGAGGAATGCTCAAGTCAATTCTCGAGAATTGACTTGAGCATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016810
VALIDATED
GOSR1 MISSION shRNA shRNA Plasmid DNA
golgi SNAP receptor complex member 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016810.2-1128s1c1
Sequence:CCGGGCCACGAGATTGGATGTGAATCTCGAGATTCACATCCAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-516s1c1
Sequence:CCGGCGAAACTCTGATCGTCTGATACTCGAGTATCAGACGATCAGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-596s1c1
Sequence:CCGGGCTCAAGTCAATTCACAGCAACTCGAGTTGCTGTGAATTGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-351s1c1
Sequence:CCGGCAGGATTATACACACGAATTTCTCGAGAAATTCGTGTGTATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-350s1c1
Sequence:CCGGGCAGGATTATACACACGAATTCTCGAGAATTCGTGTGTATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-160s21c1
Sequence:CCGGCTGACACAACACCGCTATTAACTCGAGTTAATAGCGGTGTTGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-647s21c1
Sequence:CCGGCGTGAACAGCCTGATACAAAGCTCGAGCTTTGTATCAGGCTGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-1128s21c1
Sequence:CCGGGCCACGAGATTGGATGTGAATCTCGAGATTCACATCCAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-516s21c1
Sequence:CCGGCGAAACTCTGATCGTCTGATACTCGAGTATCAGACGATCAGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-351s21c1
Sequence:CCGGCAGGATTATACACACGAATTTCTCGAGAAATTCGTGTGTATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016810.3-433s21c1
Sequence:GTACCGGGGAAAGATATTGAGTCATATACTCGAGTATATGACTCAATATCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016810.3-588s21c1
Sequence:GTACCGGAGAGGAATGCTCAAGTCAATTCTCGAGAATTGACTTGAGCATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016810
VALIDATED
GOSR1 MISSION shRNA Lentiviral Transduction Particles
golgi SNAP receptor complex member 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016810.2-1128s1c1
Sequence:CCGGGCCACGAGATTGGATGTGAATCTCGAGATTCACATCCAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-516s1c1
Sequence:CCGGCGAAACTCTGATCGTCTGATACTCGAGTATCAGACGATCAGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-596s1c1
Sequence:CCGGGCTCAAGTCAATTCACAGCAACTCGAGTTGCTGTGAATTGACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-351s1c1
Sequence:CCGGCAGGATTATACACACGAATTTCTCGAGAAATTCGTGTGTATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016810.2-350s1c1
Sequence:CCGGGCAGGATTATACACACGAATTCTCGAGAATTCGTGTGTATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-160s21c1
Sequence:CCGGCTGACACAACACCGCTATTAACTCGAGTTAATAGCGGTGTTGTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-647s21c1
Sequence:CCGGCGTGAACAGCCTGATACAAAGCTCGAGCTTTGTATCAGGCTGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-1128s21c1
Sequence:CCGGGCCACGAGATTGGATGTGAATCTCGAGATTCACATCCAATCTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-516s21c1
Sequence:CCGGCGAAACTCTGATCGTCTGATACTCGAGTATCAGACGATCAGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016810.3-351s21c1
Sequence:CCGGCAGGATTATACACACGAATTTCTCGAGAAATTCGTGTGTATAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016810.3-433s21c1
Sequence:GTACCGGGGAAAGATATTGAGTCATATACTCGAGTATATGACTCAATATCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016810.3-588s21c1
Sequence:GTACCGGAGAGGAATGCTCAAGTCAATTCTCGAGAATTGACTTGAGCATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004871
GOSR1 MISSION shRNA Bacterial Glycerol Stock
golgi SNAP receptor complex member 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-152s1c1
Sequence:CCGGGCGACAGGTATAGTTCTGATACTCGAGTATCAGAACTATACCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-357s1c1
Sequence:CCGGGCAGGATTATACACATGAATTCTCGAGAATTCATGTGTATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-523s1c1
Sequence:CCGGCGAAACTCAGATCGTCTGATACTCGAGTATCAGACGATCTGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-387s1c1
Sequence:CCGGCAAAGCAAACTTTATGGCAATCTCGAGATTGCCATAAAGTTTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-224s1c1
Sequence:CCGGCGATTGAGATTGAACAACTTTCTCGAGAAAGTTGTTCAATCTCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-204s21c1
Sequence:GTACCGGGGATCAAGCCAAGACAGAATGCTCGAGCATTCTGTCTTGGCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-117s21c1
Sequence:GTACCGGAGCAAACTATGTACAAGTTACCTCGAGGTAACTTGTACATAGTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-538s21c1
Sequence:GTACCGGGAAACTCAGATCGTCTGATAGCTCGAGCTATCAGACGATCTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-157s21c1
Sequence:GTACCGGATGGAAGACGCGACAGGTATACTCGAGTATACCTGTCGCGTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-422s21c1
Sequence:GTACCGGACGGGAAAGGGAGAATCTTATCTCGAGATAAGATTCTCCCTTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-609s21c1
Sequence:GTACCGGAGAGGAATGTTGAAGTCAATTCTCGAGAATTGACTTCAACATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-641s21c1
Sequence:GTACCGGGAACACTTTGGCCAATCGTTTCTCGAGAAACGATTGGCCAAAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004871.2-1081s21c1
Sequence:GTACCGGTGATAGTGTTGAAGCCTAATGCTCGAGCATTAGGCTTCAACACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004871
GOSR1 MISSION shRNA shRNA Plasmid DNA
golgi SNAP receptor complex member 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-152s1c1
Sequence:CCGGGCGACAGGTATAGTTCTGATACTCGAGTATCAGAACTATACCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-357s1c1
Sequence:CCGGGCAGGATTATACACATGAATTCTCGAGAATTCATGTGTATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-523s1c1
Sequence:CCGGCGAAACTCAGATCGTCTGATACTCGAGTATCAGACGATCTGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-387s1c1
Sequence:CCGGCAAAGCAAACTTTATGGCAATCTCGAGATTGCCATAAAGTTTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-224s1c1
Sequence:CCGGCGATTGAGATTGAACAACTTTCTCGAGAAAGTTGTTCAATCTCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-204s21c1
Sequence:GTACCGGGGATCAAGCCAAGACAGAATGCTCGAGCATTCTGTCTTGGCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-117s21c1
Sequence:GTACCGGAGCAAACTATGTACAAGTTACCTCGAGGTAACTTGTACATAGTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-538s21c1
Sequence:GTACCGGGAAACTCAGATCGTCTGATAGCTCGAGCTATCAGACGATCTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-157s21c1
Sequence:GTACCGGATGGAAGACGCGACAGGTATACTCGAGTATACCTGTCGCGTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-422s21c1
Sequence:GTACCGGACGGGAAAGGGAGAATCTTATCTCGAGATAAGATTCTCCCTTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-609s21c1
Sequence:GTACCGGAGAGGAATGTTGAAGTCAATTCTCGAGAATTGACTTCAACATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-641s21c1
Sequence:GTACCGGGAACACTTTGGCCAATCGTTTCTCGAGAAACGATTGGCCAAAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004871.2-1081s21c1
Sequence:GTACCGGTGATAGTGTTGAAGCCTAATGCTCGAGCATTAGGCTTCAACACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004871
GOSR1 MISSION shRNA Lentiviral Transduction Particles
golgi SNAP receptor complex member 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-152s1c1
Sequence:CCGGGCGACAGGTATAGTTCTGATACTCGAGTATCAGAACTATACCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-357s1c1
Sequence:CCGGGCAGGATTATACACATGAATTCTCGAGAATTCATGTGTATAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-523s1c1
Sequence:CCGGCGAAACTCAGATCGTCTGATACTCGAGTATCAGACGATCTGAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-387s1c1
Sequence:CCGGCAAAGCAAACTTTATGGCAATCTCGAGATTGCCATAAAGTTTGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004871.1-224s1c1
Sequence:CCGGCGATTGAGATTGAACAACTTTCTCGAGAAAGTTGTTCAATCTCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-204s21c1
Sequence:GTACCGGGGATCAAGCCAAGACAGAATGCTCGAGCATTCTGTCTTGGCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-117s21c1
Sequence:GTACCGGAGCAAACTATGTACAAGTTACCTCGAGGTAACTTGTACATAGTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-538s21c1
Sequence:GTACCGGGAAACTCAGATCGTCTGATAGCTCGAGCTATCAGACGATCTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-157s21c1
Sequence:GTACCGGATGGAAGACGCGACAGGTATACTCGAGTATACCTGTCGCGTCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-422s21c1
Sequence:GTACCGGACGGGAAAGGGAGAATCTTATCTCGAGATAAGATTCTCCCTTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-609s21c1
Sequence:GTACCGGAGAGGAATGTTGAAGTCAATTCTCGAGAATTGACTTCAACATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004871.2-641s21c1
Sequence:GTACCGGGAACACTTTGGCCAATCGTTTCTCGAGAAACGATTGGCCAAAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004871.2-1081s21c1
Sequence:GTACCGGTGATAGTGTTGAAGCCTAATGCTCGAGCATTAGGCTTCAACACTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks