EMAIL THIS PAGE TO A FRIEND

GOSR2

golgi SNAP receptor complex member 2

130 Gene Product Result for
Synonyms: Bos1 EPM6 GS27
UniProtKB ID: O14653, D3DXJ5, D3DXJ6, Q8N4B8, Q96DA5, Q9BZZ4
Gene ID:
Human(9570) Summary: This gene encodes a trafficking membrane protein which transports proteins among the medial- and trans-Golgi compartments. Due to its chromosomal location and trafficking function, this gene may be involved in familial essential hypertension. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56494) golgi SNAP receptor complex member 2
Rat(64154) golgi SNAP receptor complex member 2
sheep(101119834) golgi SNAP receptor complex member 2
domestic guinea pig(100734331) golgi SNAP receptor complex member 2
naked mole-rat(101725020) golgi SNAP receptor complex member 2
Zebrafish(324569) golgi SNAP receptor complex member 2
chicken(419973) golgi SNAP receptor complex member 2
domestic cat(101088285) golgi SNAP receptor complex member 2
cow(506198) golgi SNAP receptor complex member 2
dog(610436) golgi SNAP receptor complex member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046261 MISSION® esiRNA esiRNA targeting mouse Gosr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012511 Rosetta Predictions human pricing
NM_004287 Rosetta Predictions human pricing
NM_054022 Rosetta Predictions human pricing
NM_031685 Rosetta Predictions rat pricing
NM_019650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069562 predicted 204
2 SASI_Hs02_00306174 predicted 271
3 SASI_Hs02_00306175 predicted 269
4 SASI_Hs02_00306176 predicted 196
5 SASI_Hs02_00306177 predicted 267
6 SASI_Hs02_00306178 predicted 273
7 SASI_Hs02_00306179 predicted 269
8 SASI_Hs02_00306180 predicted 274
9 SASI_Hs02_00306181 predicted 267
10 SASI_Hs02_00306182 predicted 270
11 SASI_Hs01_00069563 predicted 217
12 SASI_Hs01_00069564 predicted 216
13 SASI_Hs01_00069565 predicted 213
14 SASI_Hs01_00069566 predicted 897
15 SASI_Hs01_00069567 predicted 850
16 SASI_Hs01_00069568 predicted 838
17 SASI_Hs01_00069569 predicted 610
18 SASI_Hs01_00069570 predicted 678
19 SASI_Hs01_00069571 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225414 predicted 209
2 SASI_Hs02_00337278 predicted 268
3 SASI_Hs02_00337279 predicted 269
4 SASI_Hs02_00337280 predicted 194
5 SASI_Hs02_00337281 predicted 270
6 SASI_Hs02_00337282 predicted 279
7 SASI_Hs02_00337283 predicted 267
8 SASI_Hs02_00337284 predicted 272
9 SASI_Hs02_00337285 predicted 269
10 SASI_Hs02_00337286 predicted 268
11 SASI_Hs01_00225415 predicted 209
12 SASI_Hs01_00225416 predicted 216
13 SASI_Hs01_00225417 predicted 210
14 SASI_Hs01_00225418 predicted 1155
15 SASI_Hs01_00225419 predicted 899
16 SASI_Hs01_00225420 predicted 1108
17 SASI_Hs01_00225421 predicted 1033
18 SASI_Hs01_00225422 predicted 996
19 SASI_Hs01_00225423 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155249 predicted 203
2 SASI_Hs02_00361945 predicted 271
3 SASI_Hs02_00361946 predicted 276
4 SASI_Hs02_00361947 predicted 192
5 SASI_Hs02_00361948 predicted 272
6 SASI_Hs02_00361949 predicted 271
7 SASI_Hs02_00361950 predicted 266
8 SASI_Hs02_00361951 predicted 273
9 SASI_Hs02_00361952 predicted 269
10 SASI_Hs02_00361953 predicted 268
11 SASI_Hs01_00155250 predicted 218
12 SASI_Hs01_00155251 predicted 219
13 SASI_Hs01_00155252 predicted 207
14 SASI_Hs01_00155253 predicted 750
15 SASI_Hs01_00155254 predicted 1050
16 SASI_Hs01_00155255 predicted 863
17 SASI_Hs01_00155256 predicted 934
18 SASI_Hs01_00155257 predicted 955
19 SASI_Hs01_00155258 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048442 predicted 355
2 SASI_Rn01_00048444 predicted 536
3 SASI_Rn01_00048445 predicted 604
4 SASI_Rn01_00048446 predicted 542
5 SASI_Rn02_00265027 predicted 249
6 SASI_Rn01_00048448 predicted 210
7 SASI_Rn01_00048449 predicted 423
8 SASI_Rn01_00048450 predicted 607
9 SASI_Rn02_00265028 predicted 300
10 SASI_Rn02_00265029 predicted 667
11 SASI_Rn01_00048443 predicted 211
12 SASI_Rn01_00048447 predicted 376
13 SASI_Rn01_00048451 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109760 predicted 574
2 SASI_Mm01_00109761 predicted 801
3 SASI_Mm01_00109762 predicted 402
4 SASI_Mm01_00109763 predicted 457
5 SASI_Mm01_00109764 predicted 945
6 SASI_Mm01_00109765 predicted 1011
7 SASI_Mm01_00109766 predicted 522
8 SASI_Mm01_00109767 predicted 650
9 SASI_Mm01_00109768 predicted 879
10 SASI_Mm01_00109769 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004287
VALIDATED
GOSR2 MISSION shRNA Bacterial Glycerol Stock
golgi SNAP receptor complex member 2
Human
25 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-435s21c1
Sequence:GTACCGGACGAATCACTGCAGTTTAACTCTCGAGAGTTAAACTGCAGTGATTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-676s21c1
Sequence:GTACCGGTGTGGTCATGTTCCTCGTGGTCTCGAGACCACGAGGAACATGACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-199s21c1
Sequence:GTACCGGCCAGATATTCAGCCGTCTAGACTCGAGTCTAGACGGCTGAATATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-400s21c1
Sequence:GTACCGGCACCACTAACGACTCTGACACCTCGAGGTGTCAGAGTCGTTAGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-177s21c1
Sequence:GTACCGGACGAAATCCAAGCAAGCATAGCTCGAGCTATGCTTGCTTGGATTTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004287.3-839s21c1
Sequence:GTACCGGGGAGTGATTGTGGTCTAATTTCTCGAGAAATTAGACCACAATCACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-315s21c1
Sequence:GTACCGGAGACTGCGCTCAGAAACTTCCCTCGAGGGAAGTTTCTGAGCGCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-422s21c1
Sequence:GTACCGGACCATACCAATGGACGAATCACTCGAGTGATTCGTCCATTGGTATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-598s21c1
Sequence:GTACCGGCAACACAGTGATGCGGCTCATCTCGAGATGAGCCGCATCACTGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-411s21c1
Sequence:GTACCGGACTCTGACACCACCATACCAACTCGAGTTGGTATGGTGGTGTCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-285s21c1
Sequence:GTACCGGACCAGTTAAAGTATGATGTCCCTCGAGGGACATCATACTTTAACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-212s21c1
Sequence:GTACCGGCGTCTAGAACGTCTGGAGATTCTCGAGAATCTCCAGACGTTCTAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-558s21c1
Sequence:GTACCGGAGAAGAAGATCCTTGACATTGCTCGAGCAATGTCAAGGATCTTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004287.3-1758s21c1
Sequence:CCGGTGTACTAATACCAGGTATATTCTCGAGAATATACCTGGTATTAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-630s21c1
Sequence:CCGGCTTTCCAGGACAAGTACTTTACTCGAGTAAAGTACTTGTCCTGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-274s21c1
Sequence:CCGGACTTCGGGTTGACCAGTTAAACTCGAGTTTAACTGGTCAACCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-188s21c1
Sequence:CCGGGCAAGCATAGACCAGATATTCCTCGAGGAATATCTGGTCTATGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-466s21c1
Sequence:GTACCGGGAAAGTTCACAACGGCATGGACTCGAGTCCATGCCGTTGTGAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-150s21c1
Sequence:GTACCGGACAAGCAGTCTGTGCACATAGCTCGAGCTATGTGCACAGACTGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-372s21c1
Sequence:GTACCGGAGCGAGAAGAGCTTCTGTCTCCTCGAGGAGACAGAAGCTCTTCTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-394s1c1
Sequence:CCGGCCACCATACCAATGGACGAATCTCGAGATTCGTCCATTGGTATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004287.2-187s1c1
Sequence:CCGGGTCTAGAACGTCTGGAGATTTCTCGAGAAATCTCCAGACGTTCTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-531s1c1
Sequence:CCGGCAGAAGAAGATCCTTGACATTCTCGAGAATGTCAAGGATCTTCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-617s1c1
Sequence:CCGGGTACTTTATGATAGGTGGGATCTCGAGATCCCACCTATCATAAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004287.2-437s1c1
Sequence:CCGGCCAGAAAGTTCACAACGGCATCTCGAGATGCCGTTGTGAACTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004287
VALIDATED
GOSR2 MISSION shRNA shRNA Plasmid DNA
golgi SNAP receptor complex member 2
Human
25 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-435s21c1
Sequence:GTACCGGACGAATCACTGCAGTTTAACTCTCGAGAGTTAAACTGCAGTGATTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-676s21c1
Sequence:GTACCGGTGTGGTCATGTTCCTCGTGGTCTCGAGACCACGAGGAACATGACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-199s21c1
Sequence:GTACCGGCCAGATATTCAGCCGTCTAGACTCGAGTCTAGACGGCTGAATATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-400s21c1
Sequence:GTACCGGCACCACTAACGACTCTGACACCTCGAGGTGTCAGAGTCGTTAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-177s21c1
Sequence:GTACCGGACGAAATCCAAGCAAGCATAGCTCGAGCTATGCTTGCTTGGATTTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004287.3-839s21c1
Sequence:GTACCGGGGAGTGATTGTGGTCTAATTTCTCGAGAAATTAGACCACAATCACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-315s21c1
Sequence:GTACCGGAGACTGCGCTCAGAAACTTCCCTCGAGGGAAGTTTCTGAGCGCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-422s21c1
Sequence:GTACCGGACCATACCAATGGACGAATCACTCGAGTGATTCGTCCATTGGTATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-598s21c1
Sequence:GTACCGGCAACACAGTGATGCGGCTCATCTCGAGATGAGCCGCATCACTGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-411s21c1
Sequence:GTACCGGACTCTGACACCACCATACCAACTCGAGTTGGTATGGTGGTGTCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-285s21c1
Sequence:GTACCGGACCAGTTAAAGTATGATGTCCCTCGAGGGACATCATACTTTAACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-212s21c1
Sequence:GTACCGGCGTCTAGAACGTCTGGAGATTCTCGAGAATCTCCAGACGTTCTAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-558s21c1
Sequence:GTACCGGAGAAGAAGATCCTTGACATTGCTCGAGCAATGTCAAGGATCTTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004287.3-1758s21c1
Sequence:CCGGTGTACTAATACCAGGTATATTCTCGAGAATATACCTGGTATTAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-630s21c1
Sequence:CCGGCTTTCCAGGACAAGTACTTTACTCGAGTAAAGTACTTGTCCTGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-274s21c1
Sequence:CCGGACTTCGGGTTGACCAGTTAAACTCGAGTTTAACTGGTCAACCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-188s21c1
Sequence:CCGGGCAAGCATAGACCAGATATTCCTCGAGGAATATCTGGTCTATGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-466s21c1
Sequence:GTACCGGGAAAGTTCACAACGGCATGGACTCGAGTCCATGCCGTTGTGAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-150s21c1
Sequence:GTACCGGACAAGCAGTCTGTGCACATAGCTCGAGCTATGTGCACAGACTGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-372s21c1
Sequence:GTACCGGAGCGAGAAGAGCTTCTGTCTCCTCGAGGAGACAGAAGCTCTTCTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-394s1c1
Sequence:CCGGCCACCATACCAATGGACGAATCTCGAGATTCGTCCATTGGTATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004287.2-187s1c1
Sequence:CCGGGTCTAGAACGTCTGGAGATTTCTCGAGAAATCTCCAGACGTTCTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-531s1c1
Sequence:CCGGCAGAAGAAGATCCTTGACATTCTCGAGAATGTCAAGGATCTTCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-617s1c1
Sequence:CCGGGTACTTTATGATAGGTGGGATCTCGAGATCCCACCTATCATAAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004287.2-437s1c1
Sequence:CCGGCCAGAAAGTTCACAACGGCATCTCGAGATGCCGTTGTGAACTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004287
VALIDATED
GOSR2 MISSION shRNA Lentiviral Transduction Particles
golgi SNAP receptor complex member 2
Human
25 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-435s21c1
Sequence:GTACCGGACGAATCACTGCAGTTTAACTCTCGAGAGTTAAACTGCAGTGATTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-676s21c1
Sequence:GTACCGGTGTGGTCATGTTCCTCGTGGTCTCGAGACCACGAGGAACATGACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-199s21c1
Sequence:GTACCGGCCAGATATTCAGCCGTCTAGACTCGAGTCTAGACGGCTGAATATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-400s21c1
Sequence:GTACCGGCACCACTAACGACTCTGACACCTCGAGGTGTCAGAGTCGTTAGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-177s21c1
Sequence:GTACCGGACGAAATCCAAGCAAGCATAGCTCGAGCTATGCTTGCTTGGATTTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004287.3-839s21c1
Sequence:GTACCGGGGAGTGATTGTGGTCTAATTTCTCGAGAAATTAGACCACAATCACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-315s21c1
Sequence:GTACCGGAGACTGCGCTCAGAAACTTCCCTCGAGGGAAGTTTCTGAGCGCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-422s21c1
Sequence:GTACCGGACCATACCAATGGACGAATCACTCGAGTGATTCGTCCATTGGTATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-598s21c1
Sequence:GTACCGGCAACACAGTGATGCGGCTCATCTCGAGATGAGCCGCATCACTGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-411s21c1
Sequence:GTACCGGACTCTGACACCACCATACCAACTCGAGTTGGTATGGTGGTGTCAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-285s21c1
Sequence:GTACCGGACCAGTTAAAGTATGATGTCCCTCGAGGGACATCATACTTTAACTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-212s21c1
Sequence:GTACCGGCGTCTAGAACGTCTGGAGATTCTCGAGAATCTCCAGACGTTCTAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-558s21c1
Sequence:GTACCGGAGAAGAAGATCCTTGACATTGCTCGAGCAATGTCAAGGATCTTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004287.3-1758s21c1
Sequence:CCGGTGTACTAATACCAGGTATATTCTCGAGAATATACCTGGTATTAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-630s21c1
Sequence:CCGGCTTTCCAGGACAAGTACTTTACTCGAGTAAAGTACTTGTCCTGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-274s21c1
Sequence:CCGGACTTCGGGTTGACCAGTTAAACTCGAGTTTAACTGGTCAACCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004287.3-188s21c1
Sequence:CCGGGCAAGCATAGACCAGATATTCCTCGAGGAATATCTGGTCTATGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-466s21c1
Sequence:GTACCGGGAAAGTTCACAACGGCATGGACTCGAGTCCATGCCGTTGTGAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-150s21c1
Sequence:GTACCGGACAAGCAGTCTGTGCACATAGCTCGAGCTATGTGCACAGACTGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004287.3-372s21c1
Sequence:GTACCGGAGCGAGAAGAGCTTCTGTCTCCTCGAGGAGACAGAAGCTCTTCTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-394s1c1
Sequence:CCGGCCACCATACCAATGGACGAATCTCGAGATTCGTCCATTGGTATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004287.2-187s1c1
Sequence:CCGGGTCTAGAACGTCTGGAGATTTCTCGAGAAATCTCCAGACGTTCTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-531s1c1
Sequence:CCGGCAGAAGAAGATCCTTGACATTCTCGAGAATGTCAAGGATCTTCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004287.2-617s1c1
Sequence:CCGGGTACTTTATGATAGGTGGGATCTCGAGATCCCACCTATCATAAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004287.2-437s1c1
Sequence:CCGGCCAGAAAGTTCACAACGGCATCTCGAGATGCCGTTGTGAACTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019650
VALIDATED
GOSR2 MISSION shRNA Bacterial Glycerol Stock
golgi SNAP receptor complex member 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-216s21c1
Sequence:GTACCGGCAAGCAAGGAGCCCTTGAATACTCGAGTATTCAAGGGCTCCTTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-166s21c1
Sequence:GTACCGGAGCAAGCATAGAGCAAATATTCTCGAGAATATTTGCTCTATGCTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-368s21c1
Sequence:GTACCGGTCTCGCACCTTCACCACTAACCTCGAGGTTAGTGGTGAAGGTGCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-549s21c1
Sequence:CCGGCATTGCTAACATGCTCGGCTTCTCGAGAAGCCGAGCATGTTAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-642s21c1
Sequence:CCGGGCTCACTTGTGCAGTCATGTTCTCGAGAACATGACTGCACAAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-531s21c1
Sequence:CCGGTCAGAAGAAGATCCTTGACATCTCGAGATGTCAAGGATCTTCTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.2-253s21c1
Sequence:CCGGCGTGTCGACCAGCTAAAGTATCTCGAGATACTTTAGCTGGTCGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-1514s1c1
Sequence:CCGGCCCTTGAAACATATTAGCAATCTCGAGATTGCTAATATGTTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-642s1c1
Sequence:CCGGGCTCACTTGTGCAGTCATGTTCTCGAGAACATGACTGCACAAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-549s1c1
Sequence:CCGGCATTGCTAACATGCTCGGCTTCTCGAGAAGCCGAGCATGTTAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-531s1c1
Sequence:CCGGTCAGAAGAAGATCCTTGACATCTCGAGATGTCAAGGATCTTCTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-253s1c1
Sequence:CCGGCGTGTCGACCAGCTAAAGTATCTCGAGATACTTTAGCTGGTCGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019650
VALIDATED
GOSR2 MISSION shRNA shRNA Plasmid DNA
golgi SNAP receptor complex member 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-216s21c1
Sequence:GTACCGGCAAGCAAGGAGCCCTTGAATACTCGAGTATTCAAGGGCTCCTTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-166s21c1
Sequence:GTACCGGAGCAAGCATAGAGCAAATATTCTCGAGAATATTTGCTCTATGCTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-368s21c1
Sequence:GTACCGGTCTCGCACCTTCACCACTAACCTCGAGGTTAGTGGTGAAGGTGCGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-549s21c1
Sequence:CCGGCATTGCTAACATGCTCGGCTTCTCGAGAAGCCGAGCATGTTAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-642s21c1
Sequence:CCGGGCTCACTTGTGCAGTCATGTTCTCGAGAACATGACTGCACAAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-531s21c1
Sequence:CCGGTCAGAAGAAGATCCTTGACATCTCGAGATGTCAAGGATCTTCTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.2-253s21c1
Sequence:CCGGCGTGTCGACCAGCTAAAGTATCTCGAGATACTTTAGCTGGTCGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-1514s1c1
Sequence:CCGGCCCTTGAAACATATTAGCAATCTCGAGATTGCTAATATGTTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-642s1c1
Sequence:CCGGGCTCACTTGTGCAGTCATGTTCTCGAGAACATGACTGCACAAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-549s1c1
Sequence:CCGGCATTGCTAACATGCTCGGCTTCTCGAGAAGCCGAGCATGTTAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-531s1c1
Sequence:CCGGTCAGAAGAAGATCCTTGACATCTCGAGATGTCAAGGATCTTCTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-253s1c1
Sequence:CCGGCGTGTCGACCAGCTAAAGTATCTCGAGATACTTTAGCTGGTCGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019650
VALIDATED
GOSR2 MISSION shRNA Lentiviral Transduction Particles
golgi SNAP receptor complex member 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-216s21c1
Sequence:GTACCGGCAAGCAAGGAGCCCTTGAATACTCGAGTATTCAAGGGCTCCTTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-166s21c1
Sequence:GTACCGGAGCAAGCATAGAGCAAATATTCTCGAGAATATTTGCTCTATGCTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.3-368s21c1
Sequence:GTACCGGTCTCGCACCTTCACCACTAACCTCGAGGTTAGTGGTGAAGGTGCGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-549s21c1
Sequence:CCGGCATTGCTAACATGCTCGGCTTCTCGAGAAGCCGAGCATGTTAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-642s21c1
Sequence:CCGGGCTCACTTGTGCAGTCATGTTCTCGAGAACATGACTGCACAAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019650.2-531s21c1
Sequence:CCGGTCAGAAGAAGATCCTTGACATCTCGAGATGTCAAGGATCTTCTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019650.2-253s21c1
Sequence:CCGGCGTGTCGACCAGCTAAAGTATCTCGAGATACTTTAGCTGGTCGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-1514s1c1
Sequence:CCGGCCCTTGAAACATATTAGCAATCTCGAGATTGCTAATATGTTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-642s1c1
Sequence:CCGGGCTCACTTGTGCAGTCATGTTCTCGAGAACATGACTGCACAAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-549s1c1
Sequence:CCGGCATTGCTAACATGCTCGGCTTCTCGAGAAGCCGAGCATGTTAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-531s1c1
Sequence:CCGGTCAGAAGAAGATCCTTGACATCTCGAGATGTCAAGGATCTTCTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019650.2-253s1c1
Sequence:CCGGCGTGTCGACCAGCTAAAGTATCTCGAGATACTTTAGCTGGTCGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)