EMAIL THIS PAGE TO A FRIEND

GOT1

glutamic-oxaloacetic transaminase 1, soluble

66 Gene Product Result for
Synonyms: ASTQTL1 GIG18 cAspAT cCAT
UniProtKB ID: P17174, B2R6R7, Q5VW80
Gene ID:
Human(2805) Summary: Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. [provided by RefSeq, Jul 2008]
Mouse(14718) glutamate oxaloacetate transaminase 1, soluble
Rat(24401) glutamic-oxaloacetic transaminase 1, soluble
Zebrafish(406330) glutamic-oxaloacetic transaminase 1, soluble
chicken(396261) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
dog(486834) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
fruit fly(36782) Glutamate oxaloacetate transaminase 1
cow(281206) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
Horse(100060793) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
domestic cat(101085155) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
domestic guinea pig(100724256) glutamic-oxaloacetic transaminase 1, soluble
naked mole-rat(101713030) glutamic-oxaloacetic transaminase 1, soluble
Goat(100861063) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
Domestic Rabbit(100340431) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
sheep(101118747) glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G7047 Anti-GOT1 (121-135) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
G6922 Anti-GOT1 (57-70) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500473 Anti-GOT1 (AA 157-167) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2500474 Anti-GOT1 (AA 22-35) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB1405887 Anti-GOT1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV48205 Anti-GOT1 antibody produced in rabbit IgG fraction of antiserum bovine, pig, rat, guinea pig, human, rabbit, mouse, horse
western blot pricing
SAB1410559 Anti-GOT1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA064532 Anti-GOT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
HPA072629 Anti-GOT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104982 Anti-GOT1, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, mouse, rat, human
western blot pricing
SAB2702344 Monoclonal Anti-Aspartate aminotransferase antibody produced in mouse clone GT638, affinity isolated antibody human
western blot pricing
SAB2702345 Monoclonal Anti-Aspartate aminotransferase antibody produced in mouse clone GT1342, affinity isolated antibody human
western blot pricing
SAB2702346 Monoclonal Anti-Aspartate aminotransferase antibody produced in mouse clone GT1255, affinity isolated antibody human, mouse
western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK055 AST Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002079 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002079 Rosetta Predictions human pricing
NM_012571 Rosetta Predictions rat pricing
NM_010324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206374 predicted 992
2 SASI_Hs01_00206375 predicted 947
3 SASI_Hs01_00206376 predicted 478
4 SASI_Hs01_00206377 predicted 644
5 SASI_Hs01_00206378 predicted 1086
6 SASI_Hs01_00206379 predicted 830
7 SASI_Hs01_00206380 predicted 793
8 SASI_Hs01_00206381 predicted 978
9 SASI_Hs02_00333155 predicted 403
10 SASI_Hs01_00206382 predicted 882
11 SASI_Hs01_00206383 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061052 predicted 994
2 SASI_Rn01_00061053 predicted 486
3 SASI_Rn01_00061054 predicted 832
4 SASI_Rn01_00061055 predicted 895
5 SASI_Rn01_00061056 predicted 528
6 SASI_Rn02_00259689 predicted 1211
7 SASI_Rn01_00061057 predicted 1262
8 SASI_Rn01_00061058 predicted 447
9 SASI_Rn01_00061059 predicted 1184
10 SASI_Rn01_00061061 predicted 619
11 SASI_Rn01_00061060 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076921 predicted 1117
2 SASI_Mm01_00076922 predicted 1020
3 SASI_Mm01_00076923 predicted 606
4 SASI_Mm01_00076924 predicted 954
5 SASI_Mm01_00076925 predicted 915
6 SASI_Mm02_00318327 predicted 850
7 SASI_Mm02_00318328 predicted 322
8 SASI_Mm01_00076927 predicted 1213
9 SASI_Mm01_00076928 predicted 510
10 SASI_Mm02_00318329 predicted 277
11 SASI_Mm01_00076926 predicted 233
12 SASI_Mm01_00076929 predicted 1219
13 SASI_Mm01_00076930 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010324
VALIDATED
GOT1 MISSION shRNA Bacterial Glycerol Stock
glutamic-oxaloacetic transaminase 1, soluble
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-1434s1c1
Sequence:CCGGCCACATGAGAAGACGTTTCTTCTCGAGAAGAAACGTCTTCTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010324.1-418s1c1
Sequence:CCGGCGATGGTACAATGGTACAGATCTCGAGATCTGTACCATTGTACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-419s1c1
Sequence:CCGGGATGGTACAATGGTACAGATACTCGAGTATCTGTACCATTGTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010324.1-223s1c1
Sequence:CCGGGTCGAACAGAAGATTGCTAATCTCGAGATTAGCAATCTTCTGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-1167s1c1
Sequence:CCGGCGAGTATTTGGTCAACGAGAACTCGAGTTCTCGTTGACCAAATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010324
VALIDATED
GOT1 MISSION shRNA shRNA Plasmid DNA
glutamic-oxaloacetic transaminase 1, soluble
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-1434s1c1
Sequence:CCGGCCACATGAGAAGACGTTTCTTCTCGAGAAGAAACGTCTTCTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010324.1-418s1c1
Sequence:CCGGCGATGGTACAATGGTACAGATCTCGAGATCTGTACCATTGTACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-419s1c1
Sequence:CCGGGATGGTACAATGGTACAGATACTCGAGTATCTGTACCATTGTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010324.1-223s1c1
Sequence:CCGGGTCGAACAGAAGATTGCTAATCTCGAGATTAGCAATCTTCTGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-1167s1c1
Sequence:CCGGCGAGTATTTGGTCAACGAGAACTCGAGTTCTCGTTGACCAAATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010324
VALIDATED
GOT1 MISSION shRNA Lentiviral Transduction Particles
glutamic-oxaloacetic transaminase 1, soluble
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-1434s1c1
Sequence:CCGGCCACATGAGAAGACGTTTCTTCTCGAGAAGAAACGTCTTCTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010324.1-418s1c1
Sequence:CCGGCGATGGTACAATGGTACAGATCTCGAGATCTGTACCATTGTACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-419s1c1
Sequence:CCGGGATGGTACAATGGTACAGATACTCGAGTATCTGTACCATTGTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010324.1-223s1c1
Sequence:CCGGGTCGAACAGAAGATTGCTAATCTCGAGATTAGCAATCTTCTGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010324.1-1167s1c1
Sequence:CCGGCGAGTATTTGGTCAACGAGAACTCGAGTTCTCGTTGACCAAATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002079
VALIDATED
GOT1 MISSION shRNA Bacterial Glycerol Stock
glutamic-oxaloacetic transaminase 1, soluble
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-387s1c1
Sequence:CCGGGCGTTGGTACAATGGAACAAACTCGAGTTTGTTCCATTGTACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-208s1c1
Sequence:CCGGGCTAATGACAATAGCCTAAATCTCGAGATTTAGGCTATTGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-682s1c1
Sequence:CCGGCCCTTCTTTGACTCAGCCTATCTCGAGATAGGCTGAGTCAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002079.1-898s1c1
Sequence:CCGGGTGCGGATTACTTGGTCCAATCTCGAGATTGGACCAAGTAATCCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-1131s1c1
Sequence:CCGGGCAGGTTGAGTATCTGGTCAACTCGAGTTGACCAGATACTCAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002079.2-1612s21c1
Sequence:CCGGACATCCCTTGAGACGAATTTGCTCGAGCAAATTCGTCTCAAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-392s21c1
Sequence:CCGGGCTAATGACAATAGCCTAAATCTCGAGATTTAGGCTATTGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-571s21c1
Sequence:CCGGGCGTTGGTACAATGGAACAAACTCGAGTTTGTTCCATTGTACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-1261s21c1
Sequence:CCGGGAACCACATCACTGATCAAATCTCGAGATTTGATCAGTGATGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-919s21c1
Sequence:CCGGTGCCTGGGCCATTCGCTATTTCTCGAGAAATAGCGAATGGCCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002079
VALIDATED
GOT1 MISSION shRNA shRNA Plasmid DNA
glutamic-oxaloacetic transaminase 1, soluble
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-387s1c1
Sequence:CCGGGCGTTGGTACAATGGAACAAACTCGAGTTTGTTCCATTGTACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-208s1c1
Sequence:CCGGGCTAATGACAATAGCCTAAATCTCGAGATTTAGGCTATTGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-682s1c1
Sequence:CCGGCCCTTCTTTGACTCAGCCTATCTCGAGATAGGCTGAGTCAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002079.1-898s1c1
Sequence:CCGGGTGCGGATTACTTGGTCCAATCTCGAGATTGGACCAAGTAATCCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-1131s1c1
Sequence:CCGGGCAGGTTGAGTATCTGGTCAACTCGAGTTGACCAGATACTCAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002079.2-1612s21c1
Sequence:CCGGACATCCCTTGAGACGAATTTGCTCGAGCAAATTCGTCTCAAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-392s21c1
Sequence:CCGGGCTAATGACAATAGCCTAAATCTCGAGATTTAGGCTATTGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-571s21c1
Sequence:CCGGGCGTTGGTACAATGGAACAAACTCGAGTTTGTTCCATTGTACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-1261s21c1
Sequence:CCGGGAACCACATCACTGATCAAATCTCGAGATTTGATCAGTGATGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-919s21c1
Sequence:CCGGTGCCTGGGCCATTCGCTATTTCTCGAGAAATAGCGAATGGCCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002079
VALIDATED
GOT1 MISSION shRNA Lentiviral Transduction Particles
glutamic-oxaloacetic transaminase 1, soluble
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-387s1c1
Sequence:CCGGGCGTTGGTACAATGGAACAAACTCGAGTTTGTTCCATTGTACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-208s1c1
Sequence:CCGGGCTAATGACAATAGCCTAAATCTCGAGATTTAGGCTATTGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-682s1c1
Sequence:CCGGCCCTTCTTTGACTCAGCCTATCTCGAGATAGGCTGAGTCAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002079.1-898s1c1
Sequence:CCGGGTGCGGATTACTTGGTCCAATCTCGAGATTGGACCAAGTAATCCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002079.1-1131s1c1
Sequence:CCGGGCAGGTTGAGTATCTGGTCAACTCGAGTTGACCAGATACTCAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002079.2-1612s21c1
Sequence:CCGGACATCCCTTGAGACGAATTTGCTCGAGCAAATTCGTCTCAAGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-392s21c1
Sequence:CCGGGCTAATGACAATAGCCTAAATCTCGAGATTTAGGCTATTGTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-571s21c1
Sequence:CCGGGCGTTGGTACAATGGAACAAACTCGAGTTTGTTCCATTGTACCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-1261s21c1
Sequence:CCGGGAACCACATCACTGATCAAATCTCGAGATTTGATCAGTGATGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002079.2-919s21c1
Sequence:CCGGTGCCTGGGCCATTCGCTATTTCTCGAGAAATAGCGAATGGCCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks