EMAIL THIS PAGE TO A FRIEND

GOT1L1

glutamic-oxaloacetic transaminase 1-like 1

46 Gene Product Result for
UniProtKB ID: Q8NHS2, A8MWL4
Gene ID:
Mouse(76615) glutamic-oxaloacetic transaminase 1-like 1
Rat(306540) glutamic-oxaloacetic transaminase 1-like 1
sheep(101111158) glutamic-oxaloacetic transaminase 1-like 1
Domestic Rabbit(100339345) glutamic-oxaloacetic transaminase 1-like 1
domestic guinea pig(100729418) glutamic-oxaloacetic transaminase 1-like 1
naked mole-rat(101721522) glutamic-oxaloacetic transaminase 1-like 1
Zebrafish(791730) glutamic-oxaloacetic transaminase 1-like 1
dog(475591) glutamic-oxaloacetic transaminase 1-like 1
cow(507913) glutamic-oxaloacetic transaminase 1-like 1
domestic cat(101099457) glutamic-oxaloacetic transaminase 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152413 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044741 MISSION® esiRNA esiRNA targeting mouse Got1l1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152413 Rosetta Predictions human pricing
NM_001014003 Rosetta Predictions rat pricing
NM_029674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205586 predicted 469
2 SASI_Hs01_00205587 predicted 448
3 SASI_Hs01_00205588 predicted 456
4 SASI_Hs01_00205589 predicted 783
5 SASI_Hs01_00205590 predicted 728
6 SASI_Hs01_00205591 predicted 200
7 SASI_Hs01_00205593 predicted 401
8 SASI_Hs02_00366120 predicted 476
9 SASI_Hs02_00366121 predicted 457
10 SASI_Hs01_00205594 predicted 1018
11 SASI_Hs01_00205585 predicted 797
12 SASI_Hs01_00205592 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064542 predicted 560
2 SASI_Rn01_00064544 predicted 966
3 SASI_Rn02_00201372 predicted 653
4 SASI_Rn01_00064545 predicted 1091
5 SASI_Rn01_00064546 predicted 499
6 SASI_Rn01_00064547 predicted 982
7 SASI_Rn01_00064548 predicted 703
8 SASI_Rn01_00064549 predicted 823
9 SASI_Rn01_00064551 predicted 1053
10 SASI_Rn02_00201373 predicted 414
11 SASI_Rn01_00064543 predicted 252
12 SASI_Rn01_00064550 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058790 predicted 613
2 SASI_Mm01_00058791 predicted 415
3 SASI_Mm01_00058792 predicted 552
4 SASI_Mm01_00058793 predicted 628
5 SASI_Mm01_00058794 predicted 648
6 SASI_Mm01_00058795 predicted 692
7 SASI_Mm01_00058796 predicted 1128
8 SASI_Mm01_00058797 predicted 495
9 SASI_Mm02_00335697 predicted 701
10 SASI_Mm01_00058799 predicted 1105
11 SASI_Mm01_00058798 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152413
GOT1L1 MISSION shRNA Bacterial Glycerol Stock
glutamic-oxaloacetic transaminase 1-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-1241s1c1
Sequence:CCGGCAGCTGTATCAATGCCAACAACTCGAGTTGTTGGCATTGATACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-713s1c1
Sequence:CCGGGAGCAAGCAGATATTCCCATTCTCGAGAATGGGAATATCTGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-1196s1c1
Sequence:CCGGCAGGAAGAAGCACATCTATATCTCGAGATATAGATGTGCTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-154s1c1
Sequence:CCGGGCAGCTTGTTAAAGACCTACACTCGAGTGTAGGTCTTTAACAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-833s1c1
Sequence:CCGGCCAGTCTCTGTCCAAGAATTTCTCGAGAAATTCTTGGACAGAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152413
GOT1L1 MISSION shRNA shRNA Plasmid DNA
glutamic-oxaloacetic transaminase 1-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-1241s1c1
Sequence:CCGGCAGCTGTATCAATGCCAACAACTCGAGTTGTTGGCATTGATACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-713s1c1
Sequence:CCGGGAGCAAGCAGATATTCCCATTCTCGAGAATGGGAATATCTGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-1196s1c1
Sequence:CCGGCAGGAAGAAGCACATCTATATCTCGAGATATAGATGTGCTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-154s1c1
Sequence:CCGGGCAGCTTGTTAAAGACCTACACTCGAGTGTAGGTCTTTAACAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-833s1c1
Sequence:CCGGCCAGTCTCTGTCCAAGAATTTCTCGAGAAATTCTTGGACAGAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152413
GOT1L1 MISSION shRNA Lentiviral Transduction Particles
glutamic-oxaloacetic transaminase 1-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-1241s1c1
Sequence:CCGGCAGCTGTATCAATGCCAACAACTCGAGTTGTTGGCATTGATACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-713s1c1
Sequence:CCGGGAGCAAGCAGATATTCCCATTCTCGAGAATGGGAATATCTGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-1196s1c1
Sequence:CCGGCAGGAAGAAGCACATCTATATCTCGAGATATAGATGTGCTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-154s1c1
Sequence:CCGGGCAGCTTGTTAAAGACCTACACTCGAGTGTAGGTCTTTAACAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152413.1-833s1c1
Sequence:CCGGCCAGTCTCTGTCCAAGAATTTCTCGAGAAATTCTTGGACAGAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029674
GOT1L1 MISSION shRNA Bacterial Glycerol Stock
glutamic-oxaloacetic transaminase 1-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-646s1c1
Sequence:CCGGGTGGACGAAACTGATGTCCATCTCGAGATGGACATCAGTTTCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029674.1-1300s1c1
Sequence:CCGGCCTGACTGGAACGAAAGCTTTCTCGAGAAAGCTTTCGTTCCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-651s1c1
Sequence:CCGGCGAAACTGATGTCCATCATTACTCGAGTAATGATGGACATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-285s1c1
Sequence:CCGGGCCTGAAATCATTCATCCAGTCTCGAGACTGGATGAATGATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-793s1c1
Sequence:CCGGCCAATCTCTGTCCAAGAATTTCTCGAGAAATTCTTGGACAGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029674
GOT1L1 MISSION shRNA shRNA Plasmid DNA
glutamic-oxaloacetic transaminase 1-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-646s1c1
Sequence:CCGGGTGGACGAAACTGATGTCCATCTCGAGATGGACATCAGTTTCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029674.1-1300s1c1
Sequence:CCGGCCTGACTGGAACGAAAGCTTTCTCGAGAAAGCTTTCGTTCCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-651s1c1
Sequence:CCGGCGAAACTGATGTCCATCATTACTCGAGTAATGATGGACATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-285s1c1
Sequence:CCGGGCCTGAAATCATTCATCCAGTCTCGAGACTGGATGAATGATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-793s1c1
Sequence:CCGGCCAATCTCTGTCCAAGAATTTCTCGAGAAATTCTTGGACAGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029674
GOT1L1 MISSION shRNA Lentiviral Transduction Particles
glutamic-oxaloacetic transaminase 1-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-646s1c1
Sequence:CCGGGTGGACGAAACTGATGTCCATCTCGAGATGGACATCAGTTTCGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029674.1-1300s1c1
Sequence:CCGGCCTGACTGGAACGAAAGCTTTCTCGAGAAAGCTTTCGTTCCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-651s1c1
Sequence:CCGGCGAAACTGATGTCCATCATTACTCGAGTAATGATGGACATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-285s1c1
Sequence:CCGGGCCTGAAATCATTCATCCAGTCTCGAGACTGGATGAATGATTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029674.1-793s1c1
Sequence:CCGGCCAATCTCTGTCCAAGAATTTCTCGAGAAATTCTTGGACAGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks