EMAIL THIS PAGE TO A FRIEND

GP1BA

glycoprotein Ib (platelet), alpha polypeptide

85 Gene Product Result for
Synonyms: BDPLT1 BDPLT3 BSS CD42B CD42b-alpha DBPLT3 GP1B GPIbA VWDP
Gene ID:
Human(2811) Summary: Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Several polymorphisms and mutations have been described in this gene, some of which are the cause of Bernard-Soulier syndromes and platelet-type von Willebrand disease. [provided by RefSeq, Mar 2010]
Mouse(14723) glycoprotein 1b, alpha polypeptide
Rat(691992) glycoprotein Ib (platelet), alpha polypeptide
chicken(420059) glycoprotein Ib (platelet), alpha polypeptide
dog(403638) glycoprotein Ib (platelet), alpha polypeptide
domestic cat(101092307) glycoprotein Ib (platelet), alpha polypeptide
cow(504977) glycoprotein Ib (platelet), alpha polypeptide
sheep(101109891) glycoprotein Ib (platelet), alpha polypeptide
domestic guinea pig(100717535) glycoprotein Ib (platelet), alpha polypeptide
naked mole-rat(101717127) glycoprotein Ib (platelet), alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500065 Anti-CD42B antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP202, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB5500066 Anti-CD42B antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP219, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
HPA013316 Anti-GP1BA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV51319 Anti-GP1BA antibody produced in rabbit affinity isolated antibody human, rabbit, canine, mouse, horse
western blot pricing
SAB4700290 Monoclonal Anti-CD42b antibody produced in mouse clone HIP1, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700289 Monoclonal Anti-CD42b azide free antibody produced in mouse clone HIP1, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700291 Monoclonal Anti-CD42b-PE antibody produced in mouse clone HIP1, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
WH0002811M2 Monoclonal Anti-GP1BA antibody produced in mouse clone 1C6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403877 Monoclonal Anti-GP1BA antibody produced in mouse clone 2E5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

ELISA

Product # Description Species Add to Cart
 
RAB1340 Human CD42b ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000173 Rosetta Predictions human pricing
NM_001109654 Rosetta Predictions rat pricing
NM_010326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105018 predicted 911
2 SASI_Hs01_00105019 predicted 416
3 SASI_Hs01_00105021 predicted 940
4 SASI_Hs01_00105022 predicted 659
5 SASI_Hs01_00105023 predicted 817
6 SASI_Hs01_00105024 predicted 991
7 SASI_Hs02_00302007 predicted 1047
8 SASI_Hs02_00302008 predicted 1090
9 SASI_Hs01_00105026 predicted 218
10 SASI_Hs02_00302009 predicted 584
11 SASI_Hs01_00105017 predicted 581
12 SASI_Hs01_00105020 predicted 260
13 SASI_Hs01_00105025 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250472 predicted 756
2 SASI_Rn02_00250473 predicted 273
3 SASI_Rn02_00250474 predicted 2191
4 SASI_Rn02_00250475 predicted 1808
5 SASI_Rn02_00250476 predicted 299
6 SASI_Rn02_00250477 predicted 2298
7 SASI_Rn02_00250478 predicted 764
8 SASI_Rn02_00250479 predicted 816
9 SASI_Rn02_00250480 predicted 2251
10 SASI_Rn02_00250481 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189829 predicted 433
2 SASI_Mm01_00189830 predicted 1853
3 SASI_Mm02_00318333 predicted 997
4 SASI_Mm01_00189831 predicted 1177
5 SASI_Mm01_00189832 predicted 754
6 SASI_Mm01_00189833 predicted 1109
7 SASI_Mm01_00189834 predicted 938
8 SASI_Mm02_00318334 predicted 1664
9 SASI_Mm01_00189836 predicted 842
10 SASI_Mm01_00189837 predicted 999
11 SASI_Mm01_00189835 predicted 1673
12 SASI_Mm01_00189838 predicted 2031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010326
GP1BA MISSION shRNA Bacterial Glycerol Stock
glycoprotein Ib (platelet), alpha polypeptide
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010326.2-1086s21c1
Sequence:CCGGTCTTTGCCTCCAACTCATAAACTCGAGTTTATGAGTTGGAGGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010326.2-1939s21c1
Sequence:CCGGGTCTCCTCTGGCTCCTATTTGCTCGAGCAAATAGGAGCCAGAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-134s1c1
Sequence:CCGGGCACACTTGTAGTATCTCCAACTCGAGTTGGAGATACTACAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010326.1-2499s1c1
Sequence:CCGGCAGAACATTGTCAGGCTACATCTCGAGATGTAGCCTGACAATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-1108s1c1
Sequence:CCGGCCACTAAGAAACAATCTACATCTCGAGATGTAGATTGTTTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-1656s1c1
Sequence:CCGGCCCAGCACCACTTTAACTAATCTCGAGATTAGTTAAAGTGGTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010326.1-2348s1c1
Sequence:CCGGGCTGAGACAATTACAGGACATCTCGAGATGTCCTGTAATTGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010326
GP1BA MISSION shRNA shRNA Plasmid DNA
glycoprotein Ib (platelet), alpha polypeptide
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010326.2-1086s21c1
Sequence:CCGGTCTTTGCCTCCAACTCATAAACTCGAGTTTATGAGTTGGAGGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010326.2-1939s21c1
Sequence:CCGGGTCTCCTCTGGCTCCTATTTGCTCGAGCAAATAGGAGCCAGAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-134s1c1
Sequence:CCGGGCACACTTGTAGTATCTCCAACTCGAGTTGGAGATACTACAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010326.1-2499s1c1
Sequence:CCGGCAGAACATTGTCAGGCTACATCTCGAGATGTAGCCTGACAATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-1108s1c1
Sequence:CCGGCCACTAAGAAACAATCTACATCTCGAGATGTAGATTGTTTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-1656s1c1
Sequence:CCGGCCCAGCACCACTTTAACTAATCTCGAGATTAGTTAAAGTGGTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010326.1-2348s1c1
Sequence:CCGGGCTGAGACAATTACAGGACATCTCGAGATGTCCTGTAATTGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010326
GP1BA MISSION shRNA Lentiviral Transduction Particles
glycoprotein Ib (platelet), alpha polypeptide
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010326.2-1086s21c1
Sequence:CCGGTCTTTGCCTCCAACTCATAAACTCGAGTTTATGAGTTGGAGGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010326.2-1939s21c1
Sequence:CCGGGTCTCCTCTGGCTCCTATTTGCTCGAGCAAATAGGAGCCAGAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-134s1c1
Sequence:CCGGGCACACTTGTAGTATCTCCAACTCGAGTTGGAGATACTACAAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010326.1-2499s1c1
Sequence:CCGGCAGAACATTGTCAGGCTACATCTCGAGATGTAGCCTGACAATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-1108s1c1
Sequence:CCGGCCACTAAGAAACAATCTACATCTCGAGATGTAGATTGTTTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010326.1-1656s1c1
Sequence:CCGGCCCAGCACCACTTTAACTAATCTCGAGATTAGTTAAAGTGGTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010326.1-2348s1c1
Sequence:CCGGGCTGAGACAATTACAGGACATCTCGAGATGTCCTGTAATTGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000173
GP1BA MISSION shRNA Bacterial Glycerol Stock
glycoprotein Ib (platelet), alpha polypeptide
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-1097s1c1
Sequence:CCGGCCTTGCATCCAACACAAGAATCTCGAGATTCTTGTGTTGGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-946s1c1
Sequence:CCGGCTATATGATTACTACCCAGAACTCGAGTTCTGGGTAGTAATCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-749s1c1
Sequence:CCGGGCAACTGTGAGATCCTCTATTCTCGAGAATAGAGGATCTCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-888s1c1
Sequence:CCGGCGTCTACAAATACCCAGGAAACTCGAGTTTCCTGGGTATTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-159s1c1
Sequence:CCGGCCTAGAAGTGAACTGTGACAACTCGAGTTGTCACAGTTCACTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000173
GP1BA MISSION shRNA shRNA Plasmid DNA
glycoprotein Ib (platelet), alpha polypeptide
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-1097s1c1
Sequence:CCGGCCTTGCATCCAACACAAGAATCTCGAGATTCTTGTGTTGGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-946s1c1
Sequence:CCGGCTATATGATTACTACCCAGAACTCGAGTTCTGGGTAGTAATCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-749s1c1
Sequence:CCGGGCAACTGTGAGATCCTCTATTCTCGAGAATAGAGGATCTCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-888s1c1
Sequence:CCGGCGTCTACAAATACCCAGGAAACTCGAGTTTCCTGGGTATTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-159s1c1
Sequence:CCGGCCTAGAAGTGAACTGTGACAACTCGAGTTGTCACAGTTCACTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000173
GP1BA MISSION shRNA Lentiviral Transduction Particles
glycoprotein Ib (platelet), alpha polypeptide
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-1097s1c1
Sequence:CCGGCCTTGCATCCAACACAAGAATCTCGAGATTCTTGTGTTGGATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-946s1c1
Sequence:CCGGCTATATGATTACTACCCAGAACTCGAGTTCTGGGTAGTAATCATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-749s1c1
Sequence:CCGGGCAACTGTGAGATCCTCTATTCTCGAGAATAGAGGATCTCACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-888s1c1
Sequence:CCGGCGTCTACAAATACCCAGGAAACTCGAGTTTCCTGGGTATTTGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000173.2-159s1c1
Sequence:CCGGCCTAGAAGTGAACTGTGACAACTCGAGTTGTCACAGTTCACTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks