EMAIL THIS PAGE TO A FRIEND

GP1BB

glycoprotein Ib (platelet), beta polypeptide

Synonyms: BDPLT1 BS CD42C GPIBB
UniProtKB ID: P13224, Q14422, Q8NG40
Gene ID:
Human(2812) Summary: Platelet glycoprotein Ib (GPIb) is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. It is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (VWF), and mediates platelet adhesion in the arterial circulation. GPIb alpha chain provides the VWF binding site, and GPIb beta contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. Mutations in the GPIb beta subunit have been associated with Bernard-Soulier syndrome, velocardiofacial syndrome and giant platelet disorder. The 206 amino acid precursor of GPIb beta is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. A 411 amino acid protein arising from a longer, unspliced transcript in endothelial cells has been described; however, the authenticity of this product has been questioned. Yet another less abundant GPIb beta mRNA species of 3.5 kb, expressed in nonhematopoietic tissues such as endothelium, brain and heart, was shown to result from inefficient usage of a non-consensus polyA signal in the neighboring upstream gene (SEPT5, septin 5). In the absence of polyadenylation from its own imperfect site, the SEPT5 gene produces read-through transcripts that use the consensus polyA signal of this gene. [provided by RefSeq, Dec 2010]
Mouse(14724) glycoprotein Ib, beta polypeptide
Rat(116727) glycoprotein Ib (platelet), beta polypeptide
domestic guinea pig(100735782) glycoprotein Ib (platelet), beta polypeptide
naked mole-rat(101717047) glycoprotein Ib (platelet), beta polypeptide
Zebrafish(798998) glycoprotein Ib (platelet), beta polypeptide
dog(608234) glycoprotein Ib (platelet), beta polypeptide
domestic cat(101080743) glycoprotein Ib (platelet), beta polypeptide
cow(100298963) glycoprotein Ib (platelet), beta polypeptide
chicken(416780) glycoprotein Ib (platelet), beta polypeptide
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000407 Rosetta Predictions human pricing
NM_053930 Rosetta Predictions rat pricing
NM_001001999 Rosetta Predictions mouse pricing
NM_010327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168488 predicted 259
2 SASI_Hs01_00168489 predicted 261
3 SASI_Hs02_00302489 predicted 633
4 SASI_Hs02_00302490 predicted 172
5 SASI_Hs02_00302491 predicted 800
6 SASI_Hs02_00302492 predicted 198
7 SASI_Hs02_00302493 predicted 625
8 SASI_Hs02_00302494 predicted 758
9 SASI_Hs02_00302495 predicted 644
10 SASI_Hs02_00302496 predicted 140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090633 predicted 659
2 SASI_Rn01_00090634 predicted 473
3 SASI_Rn01_00090635 predicted 484
4 SASI_Rn02_00266882 predicted 210
5 SASI_Rn02_00266883 predicted 211
6 SASI_Rn02_00266884 predicted 265
7 SASI_Rn02_00266885 predicted 239
8 SASI_Rn01_00090637 predicted 309
9 SASI_Rn01_00090638 predicted 383
10 SASI_Rn01_00090639 predicted 339
11 SASI_Rn01_00090636 predicted 663
12 SASI_Rn01_00090640 predicted 706
13 SASI_Rn01_00090641 predicted 340
14 SASI_Rn01_00090642 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066854 predicted 1329
2 SASI_Mm01_00066856 predicted 1841
3 SASI_Mm01_00066857 predicted 1810
4 SASI_Mm02_00286260 predicted 1858
5 SASI_Mm01_00066858 predicted 1324
6 SASI_Mm01_00066859 predicted 1847
7 SASI_Mm01_00066860 predicted 1266
8 SASI_Mm01_00066861 predicted 1820
9 SASI_Mm01_00066862 predicted 1851
10 SASI_Mm01_00066863 predicted 1811
11 SASI_Mm01_00066855 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059280 predicted 1093
2 SASI_Mm01_00059282 predicted 1608
3 SASI_Mm01_00059283 predicted 1574
4 SASI_Mm02_00318335 predicted 1621
5 SASI_Mm01_00059284 predicted 1093
6 SASI_Mm01_00059285 predicted 1614
7 SASI_Mm01_00059286 predicted 1031
8 SASI_Mm01_00059287 predicted 1586
9 SASI_Mm01_00059288 predicted 1614
10 SASI_Mm01_00059289 predicted 1570
11 SASI_Mm01_00059281 predicted 1583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001999
GP1BB MISSION shRNA Bacterial Glycerol Stock
glycoprotein Ib (platelet), beta polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001999.1-1618s1c1
Sequence:CCGGCCATCCAAGAGTTCTCTCTCACTCGAGTGAGAGAGAACTCTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001999.1-1912s1c1
Sequence:CCGGCTCCTCACTGAATAAACCGTTCTCGAGAACGGTTTATTCAGTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001999.1-1667s21c1
Sequence:CCGGAGGTGGTGCATCCTAAGAAAGCTCGAGCTTTCTTAGGATGCACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001999.1-1238s21c1
Sequence:CCGGATTGGTGCTGACCGGCAACAACTCGAGTTGTTGCCGGTCAGCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001999.1-1827s1c1
Sequence:CCGGCCAAACTGATTCCAGTACTACCTCGAGGTAGTACTGGAATCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1827s21c1
Sequence:CCGGCCAAACTGATTCCAGTACTACCTCGAGGTAGTACTGGAATCAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1703s21c1
Sequence:CCGGACAAGGACCTGCAAACTTTACCTCGAGGTAAAGTTTGCAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1907s21c1
Sequence:CCGGCCAGACTCCTCACTGAATAAACTCGAGTTTATTCAGTGAGGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001999
GP1BB MISSION shRNA shRNA Plasmid DNA
glycoprotein Ib (platelet), beta polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001999.1-1618s1c1
Sequence:CCGGCCATCCAAGAGTTCTCTCTCACTCGAGTGAGAGAGAACTCTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001999.1-1912s1c1
Sequence:CCGGCTCCTCACTGAATAAACCGTTCTCGAGAACGGTTTATTCAGTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001999.1-1667s21c1
Sequence:CCGGAGGTGGTGCATCCTAAGAAAGCTCGAGCTTTCTTAGGATGCACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001999.1-1238s21c1
Sequence:CCGGATTGGTGCTGACCGGCAACAACTCGAGTTGTTGCCGGTCAGCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001999.1-1827s1c1
Sequence:CCGGCCAAACTGATTCCAGTACTACCTCGAGGTAGTACTGGAATCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1827s21c1
Sequence:CCGGCCAAACTGATTCCAGTACTACCTCGAGGTAGTACTGGAATCAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1703s21c1
Sequence:CCGGACAAGGACCTGCAAACTTTACCTCGAGGTAAAGTTTGCAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1907s21c1
Sequence:CCGGCCAGACTCCTCACTGAATAAACTCGAGTTTATTCAGTGAGGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001999
GP1BB MISSION shRNA Lentiviral Transduction Particles
glycoprotein Ib (platelet), beta polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001999.1-1618s1c1
Sequence:CCGGCCATCCAAGAGTTCTCTCTCACTCGAGTGAGAGAGAACTCTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001999.1-1912s1c1
Sequence:CCGGCTCCTCACTGAATAAACCGTTCTCGAGAACGGTTTATTCAGTGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001999.1-1667s21c1
Sequence:CCGGAGGTGGTGCATCCTAAGAAAGCTCGAGCTTTCTTAGGATGCACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001999.1-1238s21c1
Sequence:CCGGATTGGTGCTGACCGGCAACAACTCGAGTTGTTGCCGGTCAGCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001999.1-1827s1c1
Sequence:CCGGCCAAACTGATTCCAGTACTACCTCGAGGTAGTACTGGAATCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1827s21c1
Sequence:CCGGCCAAACTGATTCCAGTACTACCTCGAGGTAGTACTGGAATCAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1703s21c1
Sequence:CCGGACAAGGACCTGCAAACTTTACCTCGAGGTAAAGTTTGCAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001999.1-1907s21c1
Sequence:CCGGCCAGACTCCTCACTGAATAAACTCGAGTTTATTCAGTGAGGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000407
GP1BB MISSION shRNA Bacterial Glycerol Stock
glycoprotein Ib (platelet), beta polypeptide
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-204s1c1
Sequence:CCGGGCTGGTGCTGACCGGCAACAACTCGAGTTGTTGCCGGTCAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-414s1c1
Sequence:CCGGGCCCTATCTGGCCGAGGACGACTCGAGTCGTCCTCGGCCAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-626s1c1
Sequence:CCGGGAGCCGGAACCGACGAGTCCTCTCGAGAGGACTCGTCGGTTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-504s1c1
Sequence:CCGGCCTTGGGCTGCTGCACGCGTTCTCGAGAACGCGTGCAGCAGCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-179s1c1
Sequence:CCGGCCGCCTTCCCTGTCGACACAACTCGAGTTGTGTCGACAGGGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000407
GP1BB MISSION shRNA shRNA Plasmid DNA
glycoprotein Ib (platelet), beta polypeptide
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-204s1c1
Sequence:CCGGGCTGGTGCTGACCGGCAACAACTCGAGTTGTTGCCGGTCAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-414s1c1
Sequence:CCGGGCCCTATCTGGCCGAGGACGACTCGAGTCGTCCTCGGCCAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-626s1c1
Sequence:CCGGGAGCCGGAACCGACGAGTCCTCTCGAGAGGACTCGTCGGTTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-504s1c1
Sequence:CCGGCCTTGGGCTGCTGCACGCGTTCTCGAGAACGCGTGCAGCAGCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-179s1c1
Sequence:CCGGCCGCCTTCCCTGTCGACACAACTCGAGTTGTGTCGACAGGGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000407
GP1BB MISSION shRNA Lentiviral Transduction Particles
glycoprotein Ib (platelet), beta polypeptide
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-204s1c1
Sequence:CCGGGCTGGTGCTGACCGGCAACAACTCGAGTTGTTGCCGGTCAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-414s1c1
Sequence:CCGGGCCCTATCTGGCCGAGGACGACTCGAGTCGTCCTCGGCCAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-626s1c1
Sequence:CCGGGAGCCGGAACCGACGAGTCCTCTCGAGAGGACTCGTCGGTTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-504s1c1
Sequence:CCGGCCTTGGGCTGCTGCACGCGTTCTCGAGAACGCGTGCAGCAGCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000407.3-179s1c1
Sequence:CCGGCCGCCTTCCCTGTCGACACAACTCGAGTTGTGTCGACAGGGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks