EMAIL THIS PAGE TO A FRIEND

GP2

glycoprotein 2 (zymogen granule membrane)

Synonyms: ZAP75
UniProtKB ID: P55259, A6NFM9, A6NJA8, Q13338, Q9UIF1
Gene ID:
Mouse(67133) glycoprotein 2 (zymogen granule membrane)
Rat(171459) glycoprotein 2 (zymogen granule membrane)
domestic cat(101084504) glycoprotein 2 (zymogen granule membrane)
cow(531420) glycoprotein 2 (zymogen granule membrane)
Horse(100051807) glycoprotein 2 (zymogen granule membrane)
dog(442972) glycoprotein 2 (zymogen granule membrane)
sheep(101119177) glycoprotein 2 (zymogen granule membrane)
domestic guinea pig(100730782) glycoprotein 2 (zymogen granule membrane)
naked mole-rat(101709061) glycoprotein 2 (zymogen granule membrane)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025989 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025989 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025989 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001502 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087311 MISSION® esiRNA esiRNA human GP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007240 Rosetta Predictions human pricing
NM_001007241 Rosetta Predictions human pricing
NM_001007242 Rosetta Predictions human pricing
NM_001502 Rosetta Predictions human pricing
NM_134418 Rosetta Predictions rat pricing
NM_025989 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232397 predicted 1024
2 SASI_Hs01_00232398 predicted 1019
3 SASI_Hs01_00232399 predicted 1204
4 SASI_Hs01_00232400 predicted 1186
5 SASI_Hs01_00232401 predicted 1425
6 SASI_Hs01_00232402 predicted 1476
7 SASI_Hs01_00232403 predicted 1255
8 SASI_Hs01_00232404 predicted 1091
9 SASI_Hs01_00232405 predicted 1512
10 SASI_Hs01_00232406 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238675 predicted 584
2 SASI_Hs01_00238676 predicted 574
3 SASI_Hs01_00238677 predicted 762
4 SASI_Hs01_00238678 predicted 753
5 SASI_Hs01_00238679 predicted 979
6 SASI_Hs01_00238680 predicted 1029
7 SASI_Hs01_00238681 predicted 813
8 SASI_Hs01_00238682 predicted 651
9 SASI_Hs01_00238683 predicted 1075
10 SASI_Hs01_00238684 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171423 predicted 578
2 SASI_Hs01_00171424 predicted 572
3 SASI_Hs01_00171425 predicted 753
4 SASI_Hs01_00171426 predicted 736
5 SASI_Hs01_00171427 predicted 976
6 SASI_Hs01_00171428 predicted 1023
7 SASI_Hs01_00171429 predicted 802
8 SASI_Hs01_00171430 predicted 641
9 SASI_Hs01_00171431 predicted 1068
10 SASI_Hs01_00171432 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204011 predicted 1020
2 SASI_Hs01_00204012 predicted 1007
3 SASI_Hs01_00204013 predicted 1190
4 SASI_Hs01_00204014 predicted 1176
5 SASI_Hs01_00204015 predicted 1409
6 SASI_Hs01_00204016 predicted 1464
7 SASI_Hs01_00204017 predicted 1241
8 SASI_Hs01_00204018 predicted 1079
9 SASI_Hs01_00204019 predicted 1505
10 SASI_Hs01_00204020 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047900 predicted 1460
2 SASI_Rn01_00047901 predicted 589
3 SASI_Rn01_00047902 predicted 990
4 SASI_Rn02_00268025 predicted 1416
5 SASI_Rn01_00047903 predicted 1127
6 SASI_Rn01_00047904 predicted 1240
7 SASI_Rn01_00047905 predicted 1556
8 SASI_Rn01_00047906 predicted 1617
9 SASI_Rn01_00047907 predicted 816
10 SASI_Rn01_00047908 predicted 1335
11 SASI_Rn01_00047899 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177131 predicted 1040
2 SASI_Mm01_00177132 predicted 1512
3 SASI_Mm02_00329441 predicted 1420
4 SASI_Mm02_00329442 predicted 1357
5 SASI_Mm01_00177134 predicted 641
6 SASI_Mm01_00177135 predicted 1263
7 SASI_Mm01_00177136 predicted 1606
8 SASI_Mm01_00177137 predicted 1048
9 SASI_Mm01_00177138 predicted 679
10 SASI_Mm01_00177139 predicted 1146
11 SASI_Mm01_00177133 predicted 1467
12 SASI_Mm01_00177140 predicted 1226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025989
GP2 MISSION shRNA Bacterial Glycerol Stock
glycoprotein 2 (zymogen granule membrane)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025989.3-1267s21c1
Sequence:CCGGCTATGTGGGTGTCCTCTTAAACTCGAGTTTAAGAGGACACCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025989.3-1164s21c1
Sequence:CCGGACGGAGCAGGAGAGTTCAATGCTCGAGCATTGAACTCTCCTGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025989.1-1820s1c1
Sequence:CCGGCCTCTGTGAATCATTTCGATTCTCGAGAATCGAAATGATTCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-684s1c1
Sequence:CCGGGCACCCAAGAATTGTGAGATTCTCGAGAATCTCACAATTCTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-1590s1c1
Sequence:CCGGGCCATTGACTATAATCGGGTTCTCGAGAACCCGATTATAGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-349s1c1
Sequence:CCGGGCACAGAGAACAACGATTCATCTCGAGATGAATCGTTGTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-1400s1c1
Sequence:CCGGCCAACGTGATTCCACCATCAACTCGAGTTGATGGTGGAATCACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025989
GP2 MISSION shRNA shRNA Plasmid DNA
glycoprotein 2 (zymogen granule membrane)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025989.3-1267s21c1
Sequence:CCGGCTATGTGGGTGTCCTCTTAAACTCGAGTTTAAGAGGACACCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025989.3-1164s21c1
Sequence:CCGGACGGAGCAGGAGAGTTCAATGCTCGAGCATTGAACTCTCCTGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025989.1-1820s1c1
Sequence:CCGGCCTCTGTGAATCATTTCGATTCTCGAGAATCGAAATGATTCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-684s1c1
Sequence:CCGGGCACCCAAGAATTGTGAGATTCTCGAGAATCTCACAATTCTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-1590s1c1
Sequence:CCGGGCCATTGACTATAATCGGGTTCTCGAGAACCCGATTATAGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-349s1c1
Sequence:CCGGGCACAGAGAACAACGATTCATCTCGAGATGAATCGTTGTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-1400s1c1
Sequence:CCGGCCAACGTGATTCCACCATCAACTCGAGTTGATGGTGGAATCACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025989
GP2 MISSION shRNA Lentiviral Transduction Particles
glycoprotein 2 (zymogen granule membrane)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025989.3-1267s21c1
Sequence:CCGGCTATGTGGGTGTCCTCTTAAACTCGAGTTTAAGAGGACACCCACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025989.3-1164s21c1
Sequence:CCGGACGGAGCAGGAGAGTTCAATGCTCGAGCATTGAACTCTCCTGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025989.1-1820s1c1
Sequence:CCGGCCTCTGTGAATCATTTCGATTCTCGAGAATCGAAATGATTCACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-684s1c1
Sequence:CCGGGCACCCAAGAATTGTGAGATTCTCGAGAATCTCACAATTCTTGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-1590s1c1
Sequence:CCGGGCCATTGACTATAATCGGGTTCTCGAGAACCCGATTATAGTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-349s1c1
Sequence:CCGGGCACAGAGAACAACGATTCATCTCGAGATGAATCGTTGTTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025989.1-1400s1c1
Sequence:CCGGCCAACGTGATTCCACCATCAACTCGAGTTGATGGTGGAATCACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001502
GP2 MISSION shRNA Bacterial Glycerol Stock
glycoprotein 2 (zymogen granule membrane)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-249s1c1
Sequence:CCGGCAGAATTACACCCTCCTGGATCTCGAGATCCAGGAGGGTGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-165s1c1
Sequence:CCGGCCCATTGAAGCCAGTTCGTATCTCGAGATACGAACTGGCTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1401s1c1
Sequence:CCGGGCTGGACATTATGACCTAGTTCTCGAGAACTAGGTCATAATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1283s1c1
Sequence:CCGGCCTTGTGAAGTATTTCATCATCTCGAGATGATGAAATACTTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1376s1c1
Sequence:CCGGGTTCTCAGTTCAGATGTTCATCTCGAGATGAACATCTGAACTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1440s1c1
Sequence:CCGGCATCTCTGTGATTCTCTTAATCTCGAGATTAAGAGAATCACAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-917s1c1
Sequence:CCGGGAGAAATCAAACCCATGCCATCTCGAGATGGCATGGGTTTGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1055s1c1
Sequence:CCGGGCCCATTGTAAGTTCCCTGAACTCGAGTTCAGGGAACTTACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-687s1c1
Sequence:CCGGCAGGACCTCAATAGTTCTGATCTCGAGATCAGAACTATTGAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1130s1c1
Sequence:CCGGCCAGAACTACACGAATCCTTACTCGAGTAAGGATTCGTGTAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-749s1c1
Sequence:CCGGGATCAAGGTGAAGGTGGACAACTCGAGTTGTCCACCTTCACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1023s1c1
Sequence:CCGGGACATGAAAGTCAGCCTCCAACTCGAGTTGGAGGCTGACTTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001502
GP2 MISSION shRNA shRNA Plasmid DNA
glycoprotein 2 (zymogen granule membrane)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-249s1c1
Sequence:CCGGCAGAATTACACCCTCCTGGATCTCGAGATCCAGGAGGGTGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-165s1c1
Sequence:CCGGCCCATTGAAGCCAGTTCGTATCTCGAGATACGAACTGGCTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1401s1c1
Sequence:CCGGGCTGGACATTATGACCTAGTTCTCGAGAACTAGGTCATAATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1283s1c1
Sequence:CCGGCCTTGTGAAGTATTTCATCATCTCGAGATGATGAAATACTTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1376s1c1
Sequence:CCGGGTTCTCAGTTCAGATGTTCATCTCGAGATGAACATCTGAACTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1440s1c1
Sequence:CCGGCATCTCTGTGATTCTCTTAATCTCGAGATTAAGAGAATCACAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-917s1c1
Sequence:CCGGGAGAAATCAAACCCATGCCATCTCGAGATGGCATGGGTTTGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1055s1c1
Sequence:CCGGGCCCATTGTAAGTTCCCTGAACTCGAGTTCAGGGAACTTACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-687s1c1
Sequence:CCGGCAGGACCTCAATAGTTCTGATCTCGAGATCAGAACTATTGAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1130s1c1
Sequence:CCGGCCAGAACTACACGAATCCTTACTCGAGTAAGGATTCGTGTAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-749s1c1
Sequence:CCGGGATCAAGGTGAAGGTGGACAACTCGAGTTGTCCACCTTCACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1023s1c1
Sequence:CCGGGACATGAAAGTCAGCCTCCAACTCGAGTTGGAGGCTGACTTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001502
GP2 MISSION shRNA Lentiviral Transduction Particles
glycoprotein 2 (zymogen granule membrane)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-249s1c1
Sequence:CCGGCAGAATTACACCCTCCTGGATCTCGAGATCCAGGAGGGTGTAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-165s1c1
Sequence:CCGGCCCATTGAAGCCAGTTCGTATCTCGAGATACGAACTGGCTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1401s1c1
Sequence:CCGGGCTGGACATTATGACCTAGTTCTCGAGAACTAGGTCATAATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1283s1c1
Sequence:CCGGCCTTGTGAAGTATTTCATCATCTCGAGATGATGAAATACTTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1376s1c1
Sequence:CCGGGTTCTCAGTTCAGATGTTCATCTCGAGATGAACATCTGAACTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1440s1c1
Sequence:CCGGCATCTCTGTGATTCTCTTAATCTCGAGATTAAGAGAATCACAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-917s1c1
Sequence:CCGGGAGAAATCAAACCCATGCCATCTCGAGATGGCATGGGTTTGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1055s1c1
Sequence:CCGGGCCCATTGTAAGTTCCCTGAACTCGAGTTCAGGGAACTTACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-687s1c1
Sequence:CCGGCAGGACCTCAATAGTTCTGATCTCGAGATCAGAACTATTGAGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1130s1c1
Sequence:CCGGCCAGAACTACACGAATCCTTACTCGAGTAAGGATTCGTGTAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-749s1c1
Sequence:CCGGGATCAAGGTGAAGGTGGACAACTCGAGTTGTCCACCTTCACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001502.1-1023s1c1
Sequence:CCGGGACATGAAAGTCAGCCTCCAACTCGAGTTGGAGGCTGACTTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks