EMAIL THIS PAGE TO A FRIEND

GP5

glycoprotein V (platelet)

95 Gene Product Result for
Synonyms: CD42d GPV
UniProtKB ID: P40197
Gene ID:
Human(2814) Summary: Human platelet glycoprotein V (GP5) is a part of the Ib-V-IX system of surface glycoproteins that constitute the receptor for von Willebrand factor (VWF; MIM 613160) and mediate the adhesion of platelets to injured vascular surfaces in the arterial circulation, a critical initiating event in hemostasis. The main portion of the receptor is a heterodimer composed of 2 polypeptide chains, an alpha chain (GP1BA; MIM 606672) and a beta chain (GP1BB; MIM 138720), that are linked by disulfide bonds. The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX (GP9; MIM 173515) and GP5. Mutations in GP1BA, GP1BB, and GP9 have been shown to cause Bernard-Soulier syndrome (MIM 231200), a bleeding disorder (review by Lopez et al., 1998 [PubMed 9616133]
Mouse(14729) glycoprotein 5 (platelet)
Rat(25259) glycoprotein V (platelet)
sheep(101103118) glycoprotein V (platelet)
domestic guinea pig(100718244) glycoprotein V (platelet)
naked mole-rat(101709884) glycoprotein V (platelet)
chicken(768872) glycoprotein V (platelet)
domestic cat(101090457) glycoprotein V (platelet)
Horse(100060025) glycoprotein V (platelet)
cow(522692) glycoprotein V (platelet)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107774 Anti-GP5 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1494 Human GPV ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010131 MISSION® esiRNA esiRNA targeting mouse Gp5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004488 Rosetta Predictions human pricing
NM_012795 Rosetta Predictions rat pricing
NM_008148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237439 predicted 830
2 SASI_Hs01_00237441 predicted 773
3 SASI_Hs01_00237442 predicted 736
4 SASI_Hs02_00337725 predicted 831
5 SASI_Hs01_00237443 predicted 545
6 SASI_Hs01_00237444 predicted 619
7 SASI_Hs01_00237446 predicted 628
8 SASI_Hs02_00337726 predicted 492
9 SASI_Hs02_00337727 predicted 232
10 SASI_Hs01_00237448 predicted 478
11 SASI_Hs01_00237440 predicted 426
12 SASI_Hs01_00237445 predicted 1004
13 SASI_Hs01_00237447 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069933 predicted 1587
2 SASI_Rn01_00069935 predicted 732
3 SASI_Rn01_00069936 predicted 1636
4 SASI_Rn01_00069937 predicted 598
5 SASI_Rn02_00260221 predicted 1582
6 SASI_Rn01_00069938 predicted 763
7 SASI_Rn01_00069940 predicted 540
8 SASI_Rn01_00069941 predicted 1694
9 SASI_Rn02_00260222 predicted 1518
10 SASI_Rn02_00260223 predicted 424
11 SASI_Rn01_00069934 predicted 1688
12 SASI_Rn01_00069939 predicted 406
13 SASI_Rn01_00069942 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162895 predicted 537
2 SASI_Mm01_00162896 predicted 1683
3 SASI_Mm01_00162897 predicted 443
4 SASI_Mm01_00162898 predicted 1342
5 SASI_Mm01_00162899 predicted 1565
6 SASI_Mm01_00162900 predicted 200
7 SASI_Mm01_00162901 predicted 1957
8 SASI_Mm01_00162902 predicted 1616
9 SASI_Mm01_00162903 predicted 1461
10 SASI_Mm01_00162904 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004488
GP5 MISSION shRNA Bacterial Glycerol Stock
glycoprotein V (platelet)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-546s1c1
Sequence:CCGGCACCTTCAGTGACCTGATAAACTCGAGTTTATCAGGTCACTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1878s1c1
Sequence:CCGGCGTGATCATCGTGTTTGCTATCTCGAGATAGCAAACACGATGATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1814s1c1
Sequence:CCGGGTCAAGATCATAGTCCGTTCTCTCGAGAGAACGGACTATGATCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-789s1c1
Sequence:CCGGGTTGTTGGATTTATCGGGAAACTCGAGTTTCCCGATAAATCCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-1050s1c1
Sequence:CCGGGCTCTTTCTTCATTCGCACAACTCGAGTTGTGCGAATGAAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-729s1c1
Sequence:CCGGGAACCAGAATCAGCTCGATTTCTCGAGAAATCGAGCTGATTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-948s1c1
Sequence:CCGGCCGAAATCACATCCGTTCCATCTCGAGATGGAACGGATGTGATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004488.1-2377s1c1
Sequence:CCGGGCACAGAGTAAGCCGGTAAATCTCGAGATTTACCGGCTTACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004488.1-1877s1c1
Sequence:CCGGCCGTGATCATCGTGTTTGCTACTCGAGTAGCAAACACGATGATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-545s1c1
Sequence:CCGGGCACCTTCAGTGACCTGATAACTCGAGTTATCAGGTCACTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1064s1c1
Sequence:CCGGCGCACAATCTGACTCTGTTGACTCGAGTCAACAGAGTCAGATTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004488
GP5 MISSION shRNA shRNA Plasmid DNA
glycoprotein V (platelet)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-546s1c1
Sequence:CCGGCACCTTCAGTGACCTGATAAACTCGAGTTTATCAGGTCACTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1878s1c1
Sequence:CCGGCGTGATCATCGTGTTTGCTATCTCGAGATAGCAAACACGATGATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1814s1c1
Sequence:CCGGGTCAAGATCATAGTCCGTTCTCTCGAGAGAACGGACTATGATCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-789s1c1
Sequence:CCGGGTTGTTGGATTTATCGGGAAACTCGAGTTTCCCGATAAATCCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-1050s1c1
Sequence:CCGGGCTCTTTCTTCATTCGCACAACTCGAGTTGTGCGAATGAAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-729s1c1
Sequence:CCGGGAACCAGAATCAGCTCGATTTCTCGAGAAATCGAGCTGATTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-948s1c1
Sequence:CCGGCCGAAATCACATCCGTTCCATCTCGAGATGGAACGGATGTGATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004488.1-2377s1c1
Sequence:CCGGGCACAGAGTAAGCCGGTAAATCTCGAGATTTACCGGCTTACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004488.1-1877s1c1
Sequence:CCGGCCGTGATCATCGTGTTTGCTACTCGAGTAGCAAACACGATGATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-545s1c1
Sequence:CCGGGCACCTTCAGTGACCTGATAACTCGAGTTATCAGGTCACTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1064s1c1
Sequence:CCGGCGCACAATCTGACTCTGTTGACTCGAGTCAACAGAGTCAGATTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004488
GP5 MISSION shRNA Lentiviral Transduction Particles
glycoprotein V (platelet)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-546s1c1
Sequence:CCGGCACCTTCAGTGACCTGATAAACTCGAGTTTATCAGGTCACTGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1878s1c1
Sequence:CCGGCGTGATCATCGTGTTTGCTATCTCGAGATAGCAAACACGATGATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1814s1c1
Sequence:CCGGGTCAAGATCATAGTCCGTTCTCTCGAGAGAACGGACTATGATCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-789s1c1
Sequence:CCGGGTTGTTGGATTTATCGGGAAACTCGAGTTTCCCGATAAATCCAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-1050s1c1
Sequence:CCGGGCTCTTTCTTCATTCGCACAACTCGAGTTGTGCGAATGAAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-729s1c1
Sequence:CCGGGAACCAGAATCAGCTCGATTTCTCGAGAAATCGAGCTGATTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004488.1-948s1c1
Sequence:CCGGCCGAAATCACATCCGTTCCATCTCGAGATGGAACGGATGTGATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004488.1-2377s1c1
Sequence:CCGGGCACAGAGTAAGCCGGTAAATCTCGAGATTTACCGGCTTACTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157945    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004488.1-1877s1c1
Sequence:CCGGCCGTGATCATCGTGTTTGCTACTCGAGTAGCAAACACGATGATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-545s1c1
Sequence:CCGGGCACCTTCAGTGACCTGATAACTCGAGTTATCAGGTCACTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004488.1-1064s1c1
Sequence:CCGGCGCACAATCTGACTCTGTTGACTCGAGTCAACAGAGTCAGATTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008148
VALIDATED
GP5 MISSION shRNA Bacterial Glycerol Stock
glycoprotein V (platelet)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008148.2-1855s1c1
Sequence:CCGGCCCTCTCTTCAGAAGTAGCTTCTCGAGAAGCTACTTCTGAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-487s1c1
Sequence:CCGGGAACCAGAATCAGCTCTCTTTCTCGAGAAAGAGAGCTGATTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-1666s1c1
Sequence:CCGGCCAGCTGTTTCGAACATTAATCTCGAGATTAATGTTCGAAACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-602s1c1
Sequence:CCGGGCTCAAGTTAAGCTTGAGAAACTCGAGTTTCTCAAGCTTAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008148.2-303s1c1
Sequence:CCGGGCACCTTCAATGACCTGGTAACTCGAGTTACCAGGTCATTGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1638s21c1
Sequence:CCGGCATCGTGTTTGCCATGATTAACTCGAGTTAATCATGGCAAACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-202s21c1
Sequence:CCGGCGAATGGACCAGGGCATATTGCTCGAGCAATATGCCCTGGTCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1663s21c1
Sequence:CCGGGGCCAGCTGTTTCGAACATTACTCGAGTAATGTTCGAAACAGCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008148.3-1787s21c1
Sequence:CCGGTGGCGTGCCATTACACTATTTCTCGAGAAATAGTGTAATGGCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1610s21c1
Sequence:CCGGTAGTAGCCCAGGCCATCATAGCTCGAGCTATGATGGCCTGGGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008148
VALIDATED
GP5 MISSION shRNA shRNA Plasmid DNA
glycoprotein V (platelet)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008148.2-1855s1c1
Sequence:CCGGCCCTCTCTTCAGAAGTAGCTTCTCGAGAAGCTACTTCTGAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-487s1c1
Sequence:CCGGGAACCAGAATCAGCTCTCTTTCTCGAGAAAGAGAGCTGATTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-1666s1c1
Sequence:CCGGCCAGCTGTTTCGAACATTAATCTCGAGATTAATGTTCGAAACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-602s1c1
Sequence:CCGGGCTCAAGTTAAGCTTGAGAAACTCGAGTTTCTCAAGCTTAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008148.2-303s1c1
Sequence:CCGGGCACCTTCAATGACCTGGTAACTCGAGTTACCAGGTCATTGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1638s21c1
Sequence:CCGGCATCGTGTTTGCCATGATTAACTCGAGTTAATCATGGCAAACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-202s21c1
Sequence:CCGGCGAATGGACCAGGGCATATTGCTCGAGCAATATGCCCTGGTCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1663s21c1
Sequence:CCGGGGCCAGCTGTTTCGAACATTACTCGAGTAATGTTCGAAACAGCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008148.3-1787s21c1
Sequence:CCGGTGGCGTGCCATTACACTATTTCTCGAGAAATAGTGTAATGGCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1610s21c1
Sequence:CCGGTAGTAGCCCAGGCCATCATAGCTCGAGCTATGATGGCCTGGGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008148
VALIDATED
GP5 MISSION shRNA Lentiviral Transduction Particles
glycoprotein V (platelet)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008148.2-1855s1c1
Sequence:CCGGCCCTCTCTTCAGAAGTAGCTTCTCGAGAAGCTACTTCTGAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-487s1c1
Sequence:CCGGGAACCAGAATCAGCTCTCTTTCTCGAGAAAGAGAGCTGATTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-1666s1c1
Sequence:CCGGCCAGCTGTTTCGAACATTAATCTCGAGATTAATGTTCGAAACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008148.2-602s1c1
Sequence:CCGGGCTCAAGTTAAGCTTGAGAAACTCGAGTTTCTCAAGCTTAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008148.2-303s1c1
Sequence:CCGGGCACCTTCAATGACCTGGTAACTCGAGTTACCAGGTCATTGAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1638s21c1
Sequence:CCGGCATCGTGTTTGCCATGATTAACTCGAGTTAATCATGGCAAACACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-202s21c1
Sequence:CCGGCGAATGGACCAGGGCATATTGCTCGAGCAATATGCCCTGGTCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1663s21c1
Sequence:CCGGGGCCAGCTGTTTCGAACATTACTCGAGTAATGTTCGAAACAGCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008148.3-1787s21c1
Sequence:CCGGTGGCGTGCCATTACACTATTTCTCGAGAAATAGTGTAATGGCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008148.3-1610s21c1
Sequence:CCGGTAGTAGCCCAGGCCATCATAGCTCGAGCTATGATGGCCTGGGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks