EMAIL THIS PAGE TO A FRIEND

GP6

glycoprotein VI (platelet)

105 Gene Product Result for
Synonyms: BDPLT11 GPIV GPVI
UniProtKB ID: Q9HCN6, Q9HCN7, Q9UIF2
Gene ID:
Human(51206) Summary: This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(243816) glycoprotein 6 (platelet)
Rat(684555) glycoprotein 6 (platelet)
dog(484303) glycoprotein VI (platelet)
cow(100336616) glycoprotein VI (platelet)
domestic cat(101093562) glycoprotein VI (platelet)
sheep(101123066) glycoprotein VI (platelet)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1495 Human GPVI ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_145298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_145298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_145298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076911 MISSION® esiRNA esiRNA human GP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083899 Rosetta Predictions human pricing
NM_016363 Rosetta Predictions human pricing
XM_001070959 Rosetta Predictions rat pricing
XM_145298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317231 predicted 449
2 SASI_Hs02_00317232 predicted 428
3 SASI_Hs02_00317233 predicted 433
4 SASI_Hs02_00317234 predicted 428
5 SASI_Hs02_00317235 predicted 333
6 SASI_Hs02_00317236 predicted 493
7 SASI_Hs02_00317237 predicted 557
8 SASI_Hs02_00317238 predicted 478
9 SASI_Hs02_00317239 predicted 554
10 SASI_Hs02_00317240 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349342 predicted 449
2 SASI_Hs01_00127760 predicted 427
3 SASI_Hs02_00349343 predicted 431
4 SASI_Hs01_00127763 predicted 427
5 SASI_Hs02_00349344 predicted 337
6 SASI_Hs02_00349345 predicted 496
7 SASI_Hs02_00349346 predicted 554
8 SASI_Hs02_00349347 predicted 482
9 SASI_Hs02_00349348 predicted 556
10 SASI_Hs02_00349349 predicted 338
11 SASI_Hs01_00127757 predicted 724
12 SASI_Hs01_00127758 predicted 687
13 SASI_Hs01_00127759 predicted 709
14 SASI_Hs01_00127761 predicted 742
15 SASI_Hs01_00127762 predicted 746
16 SASI_Hs01_00127764 predicted 784
17 SASI_Hs01_00127765 predicted 904
18 SASI_Hs01_00127766 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333408 predicted 460
2 SASI_Rn02_00333409 predicted 734
3 SASI_Rn02_00333410 predicted 445
4 SASI_Rn02_00333411 predicted 791
5 SASI_Rn02_00333412 predicted 802
6 SASI_Rn02_00333413 predicted 726
7 SASI_Rn02_00333414 predicted 421
8 SASI_Rn02_00333415 predicted 469
9 SASI_Rn02_00333416 predicted 668
10 SASI_Rn02_00333417 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_145298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425269 predicted 224
2 SASI_Mm02_00425270 predicted 249
3 SASI_Mm02_00425271 predicted 257
4 SASI_Mm02_00425272 predicted 269
5 SASI_Mm02_00425273 predicted 222
6 SASI_Mm02_00425274 predicted 223
7 SASI_Mm02_00425275 predicted 245
8 SASI_Mm02_00425276 predicted 251
9 SASI_Mm02_00425277 predicted 264
10 SASI_Mm02_00425278 predicted 257
11 SASI_Mm01_00219732 predicted 874
12 SASI_Mm01_00219733 predicted 647
13 SASI_Mm01_00219734 predicted 649
14 SASI_Mm01_00219735 predicted 613
15 SASI_Mm01_00219736 predicted 723
16 SASI_Mm01_00219737 predicted 643
17 SASI_Mm01_00219738 predicted 601
18 SASI_Mm01_00219739 predicted 869
19 SASI_Mm01_00219740 predicted 597
20 SASI_Mm01_00219741 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016363
GP6 MISSION shRNA Bacterial Glycerol Stock
glycoprotein VI (platelet)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016363.4-1036s21c1
Sequence:CCGGGTTATGTTCATGACCGCTGAACTCGAGTTCAGCGGTCATGAACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016363.4-1350s21c1
Sequence:CCGGTTCTTCAACCTCTCTAATATGCTCGAGCATATTAGAGAGGTTGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-486s1c1
Sequence:CCGGCCTACAAGAATCCCGAGAGATCTCGAGATCTCTCGGGATTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-724s1c1
Sequence:CCGGCTCATTCACAAACAAAGTCTTCTCGAGAAGACTTTGTTTGTGAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-288s1c1
Sequence:CCGGGCTGCTCCTACCAGAACGGAACTCGAGTTCCGTTCTGGTAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-747s1c1
Sequence:CCGGCAACTGAGACTTCTAGGAGTACTCGAGTACTCCTAGAAGTCTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-437s1c1
Sequence:CCGGCGGTATGGCTTTGACCAATTTCTCGAGAAATTGGTCAAAGCCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016363
GP6 MISSION shRNA shRNA Plasmid DNA
glycoprotein VI (platelet)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016363.4-1036s21c1
Sequence:CCGGGTTATGTTCATGACCGCTGAACTCGAGTTCAGCGGTCATGAACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016363.4-1350s21c1
Sequence:CCGGTTCTTCAACCTCTCTAATATGCTCGAGCATATTAGAGAGGTTGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-486s1c1
Sequence:CCGGCCTACAAGAATCCCGAGAGATCTCGAGATCTCTCGGGATTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-724s1c1
Sequence:CCGGCTCATTCACAAACAAAGTCTTCTCGAGAAGACTTTGTTTGTGAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-288s1c1
Sequence:CCGGGCTGCTCCTACCAGAACGGAACTCGAGTTCCGTTCTGGTAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-747s1c1
Sequence:CCGGCAACTGAGACTTCTAGGAGTACTCGAGTACTCCTAGAAGTCTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-437s1c1
Sequence:CCGGCGGTATGGCTTTGACCAATTTCTCGAGAAATTGGTCAAAGCCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016363
GP6 MISSION shRNA Lentiviral Transduction Particles
glycoprotein VI (platelet)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016363.4-1036s21c1
Sequence:CCGGGTTATGTTCATGACCGCTGAACTCGAGTTCAGCGGTCATGAACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016363.4-1350s21c1
Sequence:CCGGTTCTTCAACCTCTCTAATATGCTCGAGCATATTAGAGAGGTTGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-486s1c1
Sequence:CCGGCCTACAAGAATCCCGAGAGATCTCGAGATCTCTCGGGATTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-724s1c1
Sequence:CCGGCTCATTCACAAACAAAGTCTTCTCGAGAAGACTTTGTTTGTGAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-288s1c1
Sequence:CCGGGCTGCTCCTACCAGAACGGAACTCGAGTTCCGTTCTGGTAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-747s1c1
Sequence:CCGGCAACTGAGACTTCTAGGAGTACTCGAGTACTCCTAGAAGTCTCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016363.3-437s1c1
Sequence:CCGGCGGTATGGCTTTGACCAATTTCTCGAGAAATTGGTCAAAGCCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_145298
GP6 MISSION shRNA Bacterial Glycerol Stock
glycoprotein VI (platelet)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-948s1c1
Sequence:CCGGGCAACACAGGATGAGAGCTTTCTCGAGAAAGCTCTCATCCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-96s1c1
Sequence:CCGGGCTGTGTGTACTGCAAGTGATCTCGAGATCACTTGCAGTACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-289s1c1
Sequence:CCGGCCAACCATGGAAAGAAGTAATCTCGAGATTACTTCTTTCCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-268s1c1
Sequence:CCGGGATCAAGACTTTCTCTTCATTCTCGAGAATGAAGAGAAAGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-784s1c1
Sequence:CCGGCCTATGAATATCACTGCCTCTCTCGAGAGAGGCAGTGATATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_145298
GP6 MISSION shRNA shRNA Plasmid DNA
glycoprotein VI (platelet)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-948s1c1
Sequence:CCGGGCAACACAGGATGAGAGCTTTCTCGAGAAAGCTCTCATCCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-96s1c1
Sequence:CCGGGCTGTGTGTACTGCAAGTGATCTCGAGATCACTTGCAGTACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-289s1c1
Sequence:CCGGCCAACCATGGAAAGAAGTAATCTCGAGATTACTTCTTTCCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-268s1c1
Sequence:CCGGGATCAAGACTTTCTCTTCATTCTCGAGAATGAAGAGAAAGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-784s1c1
Sequence:CCGGCCTATGAATATCACTGCCTCTCTCGAGAGAGGCAGTGATATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_145298
GP6 MISSION shRNA Lentiviral Transduction Particles
glycoprotein VI (platelet)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-948s1c1
Sequence:CCGGGCAACACAGGATGAGAGCTTTCTCGAGAAAGCTCTCATCCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-96s1c1
Sequence:CCGGGCTGTGTGTACTGCAAGTGATCTCGAGATCACTTGCAGTACACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-289s1c1
Sequence:CCGGCCAACCATGGAAAGAAGTAATCTCGAGATTACTTCTTTCCATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-268s1c1
Sequence:CCGGGATCAAGACTTTCTCTTCATTCTCGAGAATGAAGAGAAAGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_145298.4-784s1c1
Sequence:CCGGCCTATGAATATCACTGCCTCTCTCGAGAGAGGCAGTGATATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks